Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1676
Contig Information
Length 550 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10c06    rwhkp10c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 495
Evalue 1.70435e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1676
GTCGCACGTAGCCGGCACCATGGGTTACATCGCGCCGGAGTACCACCAGTCGCTCAAGTTCACGGCCAAGTGCGACATCTACAGCTTCGGGGTGATCCTG
GCGGTGCTGGCGACGGGGAAGGAGCCGACGGACCAGTTCTTCGTGACGGAGGTGGAGGAGGTCGGGCTGGTCAAGTGGCTGCGCCGGGTGGTGCAGAACG
GCGACTACGCGGAGGCCATCGACCCCGCCATCGCCGGCGCCGGGCACGAGGAGCAGATCCTGCTGGTGCTGCGCATCGCCGTGTTCTGCACCGCCGACGA
ACCCAAGGAGCGGCCCGAGGCCAAGGACGTGCGCTGCATGCTCGCCCAGATCAAGAACTAGTAGTCTAGTCACCGTATAGGCGCGAGCCAAAGCTCCGTG
TAAGTATTGGTCGTCGTCGTCGTCTTCAATTGGGCATGTGTCATGCGTGACTGTGTGTAGAATAATGCTGCAAGTGCTGGGTCAGCGGGTCAAGTATGGG
GCCGGTCGATCGATAAAGACCGGAAAGGAGGCCCGACCATTTTACACAAA
page-top