Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1671
Contig Information
Length 320 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10e23    rwhkp10e23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2 (no hit)
Score 507
Evalue 1.27353e-49
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1671
CTGAGATGGTGTCCTGCTATGGTAGTTTCGGTTAAGCAGCTGGCCGGGTGACCGGCAAAGCCTACTGTATCCCGTCTTACTGCTTTTATTATTTTTCTGT
CATCGTTCCTGCCGAATAAGTTGCTCTAGATGGTCTGCTGCGTCTGCCATAGTGAGCAAAAGAGTCTGTTGTGGGGAGAATGTAATAAATATTTATGTCT
GTCGCCAATACTCTTATGGGGAGAATGATATTGTAACTCATACTACCTCCGTCCCATAATATAAGATTGTATTTGACACTATGTTCAATCAAATATTGGA
GTTCTCCGTTAAAAAAAAAA
page-top