Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1649
Contig Information
Length 725 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10a24    rwhkp10a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 382
Evalue 4.16669e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1649
GCAAATCTAGCTATCTCATCATCTCTGCCTGAGCTCACTACCACTACTATTGCTAGCTTGATCGAGATGGCCCGTTCTGCTGTTGCTCAGGTCGTGCTCG
TCGCCGTGGTGGCCGCTATGCTCCTCGCAGTCACGGAGGCGGCCGTATCGTGCGGTCAGGTGAGCTCTGCCTTGAGCCCCTGCATCTCCTATGCACGCGG
CAACGGCGCCAGCCCATCTGCGGCCTGCTGCAGCGGCGTTAGGAGTCTAGCCAGCTCAGCCCGGAGCACCGCTGACAAGCAAGCGGTGTGCAAGTGCATC
AAGAGCGCTGCTGCTGGGCTCAATGCTGGCAAGGCCGCCGGCATCCCCACAAAGTGCGGCGTTAGCGTCCCCTACGCCATCAGCTCTTCGGTCGACTGCT
CTAAGATTCACTGATCGAGCACTTGCTGCCATCGTTGTTGCTATCGTACGTCCCCTACGCCATCGTTGCTGGATCTACGCTTAGTACGTTGAGGTCACAC
ACACGCACACACACACATATATATGAATAAATGCTCTCATATTATCTCACTGCGTGAGAGAGAGACACACTGTCCAAGCAGCTCTGCATGGCCGGCCACA
CTGTTATATCGATGTTTGGTTGTTCCTCCACTCCCCGAGGTTGCTGTACTTTGTACCATGTGTACTTTTGATATATGGATTGTATACACAGCTGATCAGC
TGTACTTGCGTGCGCAAAAAAAAAA
page-top