Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1634
Contig Information
Length 1014 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10j23    rwhkp10j23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine sulfhydrylase; AltName: Full=CSase A; AltName: Full=O-acetylserine (Thiol)-lyase; Short=OAS-TL A >gi|218335|dbj|BAA02438.1| O-acetylserine (thiol) lyase [Triticum aestivum]
Score 846
Evalue 1.71074e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1634
AGAGTGTGCTGATTGAACCAACCAGGTGGCAACACAGGCATTGGGCTGGCCTTCATGGCTGCTGCCAAGGGTTACAGACTTGTACTCACAATGCCCGCCT
CCATGAGTATGGAGAGGAGAATCATCTTGAAGGCCTTTGGTGCTGAGCTGATCCTCACCGACCCACTCTTGGGAATGAAAGGAGCTGTCCCAAAAGGCGG
AAGAGCTTGCAGCAAAGACGCCCAACTCATACATCCTTCAGCAGTTCGAGAATCCTGCCAACCCAAAGATTCACTACGAGACAACTGGGCCTGAAATCTG
GAAAGGCACAGGTGGAAAGATCGATGGCCTTGTTTCTGGCATCGGGACAGGTGGTACCATTACTGGAACTGGAAAGTACCTCAAAGAGCAAAACTCTAAC
ATCAAGCTCTACGGTGTGGAGCCTACCGAGAGTGCTGTCTTAAATGGTGGAAAGCCTGGACCACACAAGATCCAAGGAATTGGAGCTGGTTTTATCCCTG
GTGTCTTGGATGTTGACATCATTGATGAAACCATACAGGTTTCAAGTGATGAGTCTATTGAGATGGCAAAGTCTCTTGCATTGAAAGAAGGATTGCTGGT
TGGGATCTCTTCTGGTGCTGCTGCAGCTGCTGCAATCAAGGTTGCTCAGAGGCCTGAAAATGCAGGGAAACTCTTTGTTGTTGTGTTCCCGAGCTTCGGA
GAGCGCTACCTTTCGTCGGTGCTCTTCCACTCCATCAAGAAGGAGGCCGAGAGCATGGTGGTCGAGTGACGCTCGGGACTCGTCTCCTCAAGCGCGCGAA
GCTGTTCTCCGAAGCCGAATCCCTCCATTCATAGGAGCCCTCTTCTACAAGAAATAAATCTTCGGCGTCCCTGCTAGTGTTGGTCTGACATCAAAGTCCT
GTCAAGTTTTAATCCCACCTTGTGTGGCAATGGGGAATACTTTTGTGTTGGCCTTGTGGTGTTTAGCAATTTGAATTACCTCCTGCCTGCCCTGTATATT
GAACTCCTCCTCTG
page-top