Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1597
Contig Information
Length 744 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp20m12    rwhkp20m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27446 [Oryza sativa Indica Group]
Score 460
Evalue 6.09941e-45
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1597
AGATTCCCCTACCTTTGCTGTTCATGCGAACTGCTTATGCAAGCGATAAGTGCATTTCCTGCCTTGGTGGATTTTGTGATGGAGATCATGTCACGCCTTG
TTAACAAGCAGATATGGAAATATCCGAAGTTATGGGTAGGATTCCTGAAGTGTGCTATCCTGATAAAACCTCAGTCCTATGGTGTGTTACTGCAGTTACC
AGCTCCACAACTCGAAAATGCCCTGAATAAGAACCCTCTACTGAAGGCGCCCTTGGTCGAGCATGCCAGCCAGCCAAACGTGCGATCAACTCTCCCGAGA
TCTATCTTGGTGGTTCTGGGTCTCGCCGAAGATCAACAGCAGCAGCCCGCACCTGAGGCACAGAGCAGCCAGAACCAGGCCGCGGAGACCAGCAGCTCCG
CCGCAGAGGCCACGACGGAAGTAACTCAGGAATCCTCCGCCGCCAGTTGACATTTCCCCCGCAGCAGTGCTGGCCTTCTCTGTATTTGCTGGAACAGAAT
GGAGGCATTTGGCAGGCGACGAAGTGCTGCCTGCATTAATGTAGTACCGGGAAAGATGGCATGGCAAGACCATGTGGCGAAGCAGTGTTCAGCTGCTGCG
CGATTTGTATAAAACATTTATTACGCTAAGAATTTGAAAATAGTGGTAGGAGAAAGTTGTTGCTGAGCCCTGCTGTTCTTTTGTTTTGGTAATCCTGTAA
TTCCAGTCCACTAAAGTGGTATGTAGAACATTAAACCAAGGCTG
page-top