Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2127
Contig Information
Length 666 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 28 Clones [Download: CSV  ,  FASTA ]
rwhfl2m15    rwhfl13p16    rwhfl34e07    rwhfl40m20    rwhfl2m16    whfl18f04    whfl36f23    whfl33j24    rwhfl2g24    whfl13p15    rwhfl33j24    rwhfl2h11    whfl5h08    rwhfl18f04    rwhfl13d13    rwhfl36f23    rwhfl5h08    rwhfl34j24    rwhfl37f23    whfl2g24    whfl13p16    whfl13d13    whfl2m15    whfl37f23    whfl40m20    whfl34e07    whfl2h11    whfl10a09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15569 [Oryza sativa Indica Group]
Score 546
Evalue 3.29448e-54
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2127
ttaacaggaaactaacaacatacaataaccaacacattgcaacacaaaCAAGCAGCTGTAGATCATAGTGTCAATAAGCATAAGTTCG*AATTTCATGCA
GGATATCGAATACATAGTACTTAGATAGCAGCGGTGTCCACACAG*AACATAAAATTCATGCAACTTCTGAGCAAAA*CTCGGCCGGTAAAACATGTGCT
CCTAACCTAGGCCTTGATAGCATACTTCCTCATGGGGAAGTACTTCTCGCGCTTCTTCTCCCTCTCCGTCTTCAAAGAGAGCTGGTGCTTGGTGAGACGC
CTGCGGATGGCGCGGGTCTTC*TTGGGGCGGAGGTCGAGCGGGAGACGCTTGTTCTTGTACGCCTCCCTCAGCGCCGACTTCTGCTTCTGCGAGATCACC
GTGAGCACCCTCGCAATCGAGGTGCGCACCACCTTGATCTTGGAGAGCTTGTTGGGGGCGCCGCCGGTGACCTTGGCGACGCGGAGGAGGGAGAGCTCCG
CCTTGAGGTCCTTGAGCTGGCCCTGCAGCTCCGCCTTGTTCTTCCCCCTCAGCTCGTGCACCTTGATCCGGGCCATTGCTGCTGGCGAGCTGGTCTAGCG
GCGGGAGCGGCGGCGGCGGCGGGCGAGGGGATGAAAATGAGACGCTGAGGAgccggtTCTCgacga
page-top