Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2115
Contig Information
Length 827 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 27 Clones [Download: CSV  ,  FASTA ]
rwhfl17a10    rwhfl8d12    rwhfl13n13    rwhfl8f17    rwhfl24l18    rwhfl54j24    rwhfl46c19    rwhfl9m08    rwhfl24l17    rwhfl13b16    rwhfl10b10    rwhfl41c24    rwhfl23g17    rwhfl14a03    rwhfl41e20    rwhfl13b22    whfl41e20    whfl24l17    whfl17a10    whfl9m08    whfl24l18    whfl54j24    whfl8f17    whfl41c24    whfl46c19    whfl10b10    whfl14a03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0123200 [Oryza sativa (japonica cultivar-group)] >gi|113638678|dbj|BAF25983.1| Os10g0123200 [Oryza sativa (japonica cultivar-group)]
Score 83
Evalue 2.4806
Total Hit Count 4
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2115
atTTATAACAAATCTCAAAACATACCACAACCTACTGGATTGGACGTGGAAGAGAAAAATACAATCAGAAGCATACACCAACTTGGACTCGGACATGGAA
AACATACACCAACTTGGACTCGGACATGGAACCAATCGCGAACCATACACCA*ACTCGGACTGGCAAAGGTTCTATACTAATATAAATACCCAGCTCTCA
GAGATTGAACGCCCAGAGAAAAAAGTGCCACCAGCTTAGTACACGCCAAGCAATCTCCAAGCTACAGCGCCAACCAAAACAAAGGAGCCGTCAAGTATGT
TCCTTGTCTCCAGTTTTCGTTCTTCCCAATGAATTCTTGAATCTCACACATGGTATTTGATACTCATCAGTCCTATGTTTGATGTCCAGTAAAAAAATAC
CATGTTTCATGCATCTCACATGCCAGGATGCTCATCCGATACATATTGACTTCACATTCCAGGCCAGTCTAGCAACAAATTATCTTGTATTGCATTAAAA
AAAAATTCTTTCCATCCTGCTTGAGATGTATCCTCTTAGAAATTACTATTGGATAGTAAACATAAACTGGAACTTCACCAAGCAATTGATTTTGGCACAT
TGAAGAAAATGCTCAAAACAAATTTGGAGCGGAGAGCCTTTGCAATATTGGAGGCGACGTCACAGAAGCAGCGGGGTCGAGGATGGGTGTGAAGACGAGC
TCCCCGTCGCCCTTCTAGAAGAAACTGAGGACGGGGGGCCTCCGGTGGTAGGAGTCCACTTCCGCCTCCGCCTCCGCCTTCGCCATCGCCGCTCTGCTTA
TGCGAAGAAACCC*TAGACTTCGgttc
page-top