Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2104
Contig Information
Length 959 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 25 Clones [Download: CSV  ,  FASTA ]
rwhfl18k13    rwhfl47p19    rwhfl17m01    rwhfl30h11    rwhfl17d21    rwhfl18k14    rwhfl17e21    rwhfl10g11    rwhfl6d11    rwhfl6d12    rwhfl6d24    rwhfl17f10    rwhfl17e22    rwhfl31h11    whfl18k13    whfl6d11    whfl30h11    whfl17e21    whfl18k14    whfl31h11    whfl10g11    whfl17e22    whfl17d21    whfl47p19    whfl17f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proteasome subunit beta type 4 precursor [Zea mays]
Score 1065
Evalue 4.30775e-114
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2104
aagACTTTTAAGTCAAATTATAAACATGTCATACAGAGCAAATGTGGACTTCAGTCATATTCGGATCAAACGCTCACAAGGGCTGAAACTGTTTCAGCAG
CACAGTTTGCTTCGTTTCCAAGCTCATGGCCTACCATGTTCCTACAGCACCCTTGGACGGGTTCTCAAAGGCGGCAAACCCCCAGTTGGTCTTCAGAGCA
TACGGCGGGTAGATGGTTGATCCCTCGGTCGTGATCTTGGCAATCTGGAATTTGTTGATGGATGACCGGTCACGGTACAGCAGGACCAGCAAGCACTTCT
CAATCAGCTTAACGGCTTCTTCAAAAGTCATGTCCTCGCGCCATTCACCACGAAGTATTGGGATTGCCATATGGTTCCCAAATCCAGTGGCAATGTGGTT
CTCCTCAAAGTGTGTACCAATCATGTTAACCATGCCAAGATACTTCTCATCGCCCTTTGGGCCCTTTTTCACTCCACCAAGCACCAGGGAGTTCCATAGA
GGGTCAAACTTATTGCGCCTGTTGTACATTACTCTTGTCAGGTAGGCATGGATTTCCTTGGGGCCCAATGAGTTCCCATCATCCCACATATGATCATTCA
AAGTTAATTCATCC*AGATAGCGCAAAATCTCCTGGAAATCACTGAACTCCCCACT*CCCTCCAATAAGGCTATGCTTTCCAACCGCCTTGATACGCTCC
ACACTCTTGTATCGCAAAGTTGACCCATAGGAGGCTCCAGTATCACATGCCATGATCACACCATCCTTGTATTTCATTGCAATCACCGAGTTACCAGTCA
CATAAGGGTTCAGTGTCCTCTGCGTCCCATCTCCTCCTCCGGCCGCCGCCGCGGTCGCGTCCATTGGTGCGCGTGGGGGGTTGATGCGGCTTGGTTTCGC
TCGTCGGAGGAAAACCTCGGCTCGGCTGCGGCTGGGGATGGTGGTGTGGCCCTCTCtcc
page-top