Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1245
Contig Information
Length 885 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10d06    rwhkp10d06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein S1 - Phalaris coerulescens
Score 705
Evalue 2.10075e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1245
CGGCGGCGGCGAGCGTGCGACCTACGACCACCAGACGACCCAACCGACCCACTGACCCACACCACCGGAGAGCTCTTCCTTTTACGTCAATCAATCGAAC
CCAGTTAAAGAACCTCTTAATTGCCCGCCAGGAGATCCGCCAGGCTTATCTTCTCCGTCTCCTCCGACCTCACCTCGCCCCCTCGCCCCGCGGCTTCTGG
GCTCCTTGGCGCCAAAATCCCCGCTTCCGATCCCAGGCGTTCAGGAAACAAGGGGCCTTTCATTCAGCGATTCCTGCCAGTGTCAGTTCGCCATGGGGGG
CTGTGTGGGCAAGGGTCGTAGCATTGTGGAGGAAAAGCTTGATTTCAAAGGTGGAAATGTGCATGTCATAACAACCAAAGAGGACTGGGACCAGAAGATT
GAAGAAGCAAACAAGGATGGGAAAATAGTTGTGGCAAACTTCAGCGCTTCGTGGTGTGGGCCATGCCGTGTCATTGCACCTGTTTATGCTGAGATGTCCA
AGACTTACCCTCAACTCATGTTCTTGACAATTGATGTTGATGACCTAATGGATTTCAGCTCAACATGGGACATCCGTGCAACCCCGACGTTCTTCTTCCT
CAAAAACGGCCAGCAGATCGACAAGCTCGTCGGCGCCAACAAACCTGAGCTCGAGAAGAAAGTACAAGCTCTTGGTGATGGCAGTTGAACCATGCTACAG
AATTAGAACAGAGCCAGCTTGTCATTGCTTATATATCTGTATTGCCATGCTTGTGTGTCTTATGTGTTGCATGATAGTTTCCTGGTGTACAGTTTCCGTG
TCTTTTCCGTCTAGACAATGTTTTACAAATTTTGCGACACGCATATGCATATGCTGTGAAAACTGTAAGATGACCCTGCTGGTAA
page-top