Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2099
Contig Information
Length 652 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 25 Clones [Download: CSV  ,  FASTA ]
whfl26o11    rwhfl26o11    rwhfl54b16    rwhfl3b09    rwhfl26o12    rwhfl29d13    rwhfl29a01    rwhfl10a23    rwhfl32f21    rwhfl3d01    rwhfl27o11    rwhfl52j11    rwhfl33f21    whfl52j11    whfl32f21    rwhfl34f21    whfl10a23    whfl26o12    rwhfl30a01    whfl29a01    whfl54b16    whfl3b09    whfl30a01    whfl27o11    whfl29d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acidic ribosomal protein P2 [Triticum aestivum] >gi|32400824|gb|AAP80644.1|AF475123_1 acidic ribosomal protein P2a-2 [Triticum aestivum]
Score 312
Evalue 4.25438e-27
Total Hit Count 331
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2099
ttaaaggaccaaaatTGGATAGCAAAGGTATGGTTCACCAGTAAATCAACCAGCAACCAGGGG*CTG*AATTACATATCAAAACATTGTCTTGCCAGTGT
TTCACAACTCA*GCTAAATAAAGGCTAAAACAT*CATTGACTCTAGTTTCCTGGCCAAGGATAGATACTTCAGACACAAGGTGCCCCACAACTTAGTCGA
ACAGACTGAAGCCCATGTCATCATCACTCTCTTCCTTCTCCACGACCTTCTCTTCTTTCTTTGACTCAGCTGCAGGGGCAGCAGCACCTCCAGCAGCAGG
GGCAGCAGCTGAAACAGCCACACCACCACCACCAGATGGAACCGCAGCAAACTTCTCCCTACCAGCAGCCAAGAGCTCGGTGATGTCCTTGCCCTTCACT
TGGGACAGCAT*GAGTTCCATCTTCTCATTGTCGATTTCACAACCAACAGACTCAAGAATGGATGTCAGGTCCTCTGCAGAGGGGCTGGCGTTGCCAGAG
AGGTAAGCAAGCAGATAGGCAGCAATGAACTTCATCTTGGATCGGAGAAGGAAGGAGAGAGCTGAAGGCGGGGCGGCGGCGGAGGGCTCGACCGATCTGC
TAGGGTTT*CTGCGA*GTCATCGCTGTTCCAGACAGCGATgactcgacgaat
page-top