Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2097
Contig Information
Length 839 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 25 Clones [Download: CSV  ,  FASTA ]
rwhfl10b17    rwhfl18i09    rwhfl39c08    rwhfl8j19    rwhfl2h23    rwhfl54a05    rwhfl34d21    rwhfl20j13    rwhfl37f19    rwhfl8l19    rwhfl22d02    rwhfl54b05    rwhfl39c19    rwhfl37f20    rwhfl54a17    whfl10b17    whfl8l19    whfl39c08    whfl54a05    whfl20j13    whfl54a17    whfl34d21    whfl8j19    whfl18i09    whfl54b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0839700 [Oryza sativa (japonica cultivar-group)] >gi|15623831|dbj|BAB67890.1| putative ubiquitin carrier protein UBC7 [Oryza sativa Japonica Group] >gi|21104618|dbj|BAB93210.1| putative ubiquitin carrier protein UBC7 [Oryza sativa Japonica Group] >gi|113534286|dbj|BAF06669.1| Os01g0839700 [Oryza sativa (japonica cultivar-group)] >gi|125528325|gb|EAY76439.1| hypothetical protein OsI_04373 [Oryza sativa Indica Group] >gi|125572583|gb|EAZ14098.1| hypothetical protein OsJ_003923 [Oryza sativa (japonica cultivar-group)] >gi|215679024|dbj|BAG96454.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704452|dbj|BAG93886.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767293|dbj|BAG99521.1| unnamed protein product [Oryza sativa Japonica Group]
Score 744
Evalue 5.74613e-77
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2097
attaTGGTAAGTAGCAGCTCTCCCAAGTTTCTCAATATTGATAGCCGAAGCCACACAATTACAACAACCAGACCCTTAGAATATGCGTTGCGTTTTCAGA
GTCAAAACCAAGACCTCCACAGGAGACAGGCTAATGGAAAATATACAGGG*G*AGAAGTGAAATTGCTAGTGTCGGATGGACATTTGGAGATCGACAGCA
AAACCCTCCACACCTGAAATGGCATGGCTAACTTCCCCAGTACTCCCATTTTATTCAGAGCATTTCCTGGGATTTCCGTACGGCGCGCCTGACCTTCTTC
TTGAACTCATCCTGCTTCTCTCTCCAGTCCTTAGCTGCTTCAATATTTGCCGGTGATTCATCATTTGGACTAG*AAAGCATCGAAATGATGCTTAATACT
ATACTCTCAACCGTATGGACTGGTGTCCAACGCTCACTCGCGAGCTCGTATCCGT*TGGGATCATCACCAGGTGGATGAAGAATAGAAATGCATACCCGC
CCATCCGGATAAACATTAGGATGCCACATTTCAGAAGTGAATCTGACTGTTGGAGGGCTGTTCGGATAATTTTGTGGGAAGCTCATTATTGCATTGAAAT
AGCCTCCATCATATAGGGTCTCGGGCGGGCCGATGATGGTGACCTGCCACTCGAAGACGTTGCTGTCGTCGACGAGCCCGGCTGAAAACCCATCGACGGG
GTGCTTCGCGAGATCTCGGAGCTGCTTCTGGAGGAGGAGGCTCGCCTGGCTGGAGGCGGTGGCCATGGGATCGGCGGCGGCTAGGGTTTTCGCGGCGGGC
GGGGCGGAGGAATAATTCGCGGCCTCGGTGGGCGGTGac
page-top