Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2083
Contig Information
Length 955 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 24 Clones [Download: CSV  ,  FASTA ]
whfl32i13    whfl52i09    whfl20l21    whfl49d11    whfl30c05    whfl26f21    whfl11l07    whfl2a16    whfl25f21    whfl37l20    whfl38l20    whfl10g09    whfl48p04    whfl47h05    whfl45e11    rwhfl10g09    rwhfl2a16    rwhfl37l20    rwhfl13i19    rwhfl52i09    rwhfl38l20    rwhfl47h05    rwhfl49d11    rwhfl32i13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-beta [Zea mays] >gi|195636102|gb|ACG37519.1| elongation factor 1-beta [Zea mays]
Score 546
Evalue 6.1516e-69
Total Hit Count 443
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2083
ctCTCGGTCTCTAGGGTTTTGGGACTTTAGCCTCCTGCGCCGCCGCCGCCGCCGCCCAGCGAATTCGACAAGCCCCCGAGCTCGCCGGATCCGATGGCCG
TCACGTTCTCCGACCTCCACACCGCCGACGGGCTCAAGGCCCTCGAGGCGCACCTCGCCGGCAAGACCTACATCTCCGGCGATGGGATCACCAAGGACGA
CGTCAAGGTGTTTCGCGGCGGTGCCCGTGAAGCCCAGCGCCGAGTTCCCGAACGCTGCCCGCTGGTACGACACCGTCGCCGCGGCTGTTGCTTCAAGGTT
CCC*TGGCCAGTCCTCTGGGGTGAGTGCATCATCGGCTCCTGCTGCAGCTGCTCCTGCCGCTTCCAAGGATGAAGATGACGATGATGACATGGATCTGTT
TGGCGATGAGACCGAGGAGGACAAGAAAGCTGCAGCTGAGCGTGAGGCTGCCAAGCCTGCAAAGAAGAAAGAAAGTGGCAAATCCTCCGTCCTCATGGAC
ATCAAGCCATGGGACGATGAGACTGACATGAAGAAGTTGGAGGAGGCTGTCCGCAGTGTTCAAATGGAGGGTCTCACCTGGGGTGCATCTAAGCTTATGC
CTGTGGGTTATGGCATCAAGAAGCTCCAGATCATGCTGACGATCATCGATGACCTTGTGTCCGTCGACACTCTTATTGAGGAAGTGCTTTGCGAGGCGCC
CATCAACGAATATGTCCAGTCGTGTGACATCGTTGCCTTCAACAAGATCTAGAATCTTTGTTCTCCCACCTG******CTGGATTCTTGGTACTGGGATT
GGTCGATCTGGAAAACATTATGTCGTCCCATTTAGTTACCCCTCTTACAGAAATGCTACTGGTTTTGTTTTTGAGTGATGCCCTGGTCTTGAATGTCTGC
TACCTTTAAATAGTTGAACTGCTGAGCGGTTTGTAATGGCGAAACATCTATCatg
page-top