Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1017
Contig Information
Length 1160 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10b11    rwhkp10b11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha tubulin-1D [Triticum aestivum] >gi|90289624|gb|ABD92944.1| alpha tubulin-1A [Triticum aestivum]
Score 1371
Evalue 1.91029e-149
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1017
GATTCTTGGTGTTCAATGCTGTCGGTGGTGGAACTGGATCAGGACTGGGCTCTCTGTTGTTGGAGCGCCTCTCGGTTGATTATGGCAAGAAATCTAAGCT
TGGTTTCACCATTTACCCTTCCCCGCAGGTCTCGACAGCTGTTGTGGAACCATACAACAGTGTCCTCTCCACTCACTCTTTGCTTGAGCACACCGACGTT
GCGGTCCTCCTAGATAACGAGGCTATCTATGACATATGCCGGAGGTCTCTTGACATCGAGAGGCCAACCTACACCAACTTGAACAGGCTGATATCACAGA
TCATATCCTCACTTACCACCTCGCTGAGGTTCGATGGTGCCATCAATGTGGATGTCACAGAGTTCCAGACCAACCTCGTCCCTTACCCACGTATCCATTT
CATGCTTTCGTCGTATGCCCCTGTTATCTCTGCCGAGAAGGCTTACCATGAGCAGCTCTCTGTGCCTGAAATCACCAATGCTGTCTTTGAGCCCTCAAGC
ATGATGGCCAAGTGTGACCCTAGGCATGGCAAATATATGGCCTGCTGCTTGATGTACCGTGGTGATGTTGTTCCCAAGGACGTCAATGCCGCAGTCGCAA
CCATCAAAACCAAGAGAACTGTCCAGTTCGTCGACTGGTGCCCTACCGGGTTCAAGTGTGGCATCAACTACCAGCCACCCTCCGTTGTCCCCGGCGGCGA
CCTGGCAAAGGTTCAGCGGGCCGTGTGCATGATCAGCAACAACACTGCCGTTGCCGAAGTGTTCTCGCGCATCGACCACAAGTTCGACTTGATGTACGCC
AAGCGCGCGTTCGTGCACTGGTACGTCGGCGAGGGCATGGAGGAAGGTGAGTTCTCGGAGGCCCGTGAGGACTTGGCCGCTCTCGAGAAGGACTACGAGG
AGGTTGGCGCCGAAGGCGCAGACGATGAGGGCGACGAGGGGGATGACTACTAAGTAGCTGGTTAATAAGTAGTTGGCTGGTTAATGATTGGCTTTGATCT
GTATACTCAGTAAGTATGGTTCCATTGCGTTACATATTGATTGCTGTTATGCGTGTTTCCTTTTCTTGTAATGTACTGAAGTTGTTGTTAGGGTGGCCAT
GATTGTTGATACCCCATTTCCTCATTTTGGCTTTCGATGCTACTCGTCCCATGTTTGGTG
page-top