Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2076
Contig Information
Length 1157 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 23 Clones [Download: CSV  ,  FASTA ]
rwhfl19d09    rwhfl51n20    rwhfl10g21    rwhfl7l10    rwhfl52n01    rwhfl48k03    rwhfl18n20    rwhfl6p15    rwhfl7d14    rwhfl4c23    rwhfl24c15    rwhfl19d10    whfl19d09    whfl7l10    whfl4c23    whfl18n20    whfl7d14    whfl10g21    whfl6p15    whfl52n01    whfl51n20    whfl48k03    whfl19d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-protein ligase/ zinc ion binding protein [Zea mays]
Score 531
Evalue 4.79914e-52
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2076
atgGAGAAGAGAAGGGTACAAGGCTATTAGCCTAATACATACAACATTTTTAAGTTGCCGCAAACAATATACAGAAGGCTACAGGCAAATTTGTAAAACC
CATTTCAGGCAGAAGAAGGCTATCCACTCTGTTTATCAGGTTAAACCCATTTCAGGCAGAAGGCTATCCACTATCTTTATCAGGTTAACCC*ATTTCAGG
CAGAAGGTTATCCAGTCCGGTCATCAGGACGATGAACTCCTACCGACCCATTTCCATACATTCATCTAGGTGATGATGATACACAATGCTCCCAAGCAGA
AGATCCACCATGGTTCTCCCTGGGAGGACTCCTGACCCTTAACGGGAGGTGTTAGGAAGGTAAATGCGATGGAAATTGTTCATCTTCAGGTGCTTCCGGC
AGGTAGGACATTTCTTCTGGTACTGGATGGCTTGCTTGATGCAGTTTGTACAGAAGATGTGGCCGCACATTGTTGTGGCGGGCTCGTCCAACTTGTTCCA
ACACACCGGGCAGGTGAAGATGGGTTCCTTTGGAGCCACCTTCACAGGCTCTTTGCTAGTTTTCCCCGCATTTTTTGACTGTAAGCTGGACCCTTCTCCT
*GTTTCTGGAGAGATGTTTATTACAGGGGAAACTCTTGGGCGTTTGTTCCTTGTGTTATGAGAAAGCACTGTTGCATTATCATCATGAGACACTCCTTGC
C*GGATAGCATGTACATCGAGATCAACTACTGTCACAGGCTGCCTCCTGGGTCTCCGGTTCCTCCTCTGAGGAGGCACTTGTGAAGCTGATACGACCTGC
ACTTCATCCTCGAGGGCTTCCACATCAATGGGTGAGGTGCGCGCGCCAGCGTTAGAGGTCGATACTCCACGTCGGCTGCCCGCCGCTGGGGGGGTTGAGA
CCAAGTTCACGACGACCTTATCAGCATCTTGTGATTGCCTTCTGGAGGCACGCCGTGTGCCGTTGGCAGTACTCATGCTCCCTTAAGCTCTTGAATCGAC
CGCGCTCACCCGACGAACCGAGCTCGACCGGACGCGCAGAGAAGGCAGCCGCCGCGCCGCGCCGCCGGCCCGCTCACTCGATTTTTTTTCTTCGCTCGGC
GCTTCCTCCTCCACCTCCTCCCCTCTCCCTGCCCTGCCTGTTTTGAATGAAAAGGat
page-top