Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig962
Contig Information
Length 745 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp2i01    rwhkp2i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 864
Evalue 5.61981e-91
Total Hit Count 469
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig962
GATCTTCAGAACGATGAGGACCAGGCCTACAGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACT
TCACCACTGACAAGCTCAGGTCTCTTGTGAGGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTT
CACCATTGGCTTCACGAAGAGACGCCCAAACCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATC
ATGGTCAACCAAGCTGCAAGCTGTGACTTGAAGGAGCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCT
TCCCCCTCCAGAACGTGTACGTCCGCAAGGTGAAGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGA
TGTTGGTGTGAAGCTTGACAGGCCTGCTGATGGAGATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTG
CTGCTTCATATCTAGAAGATGATATATGTGCCACCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCC
TANCCAGCGTTCAGTTATCTTATTTTGTTCGTGTTAAAAAAAAAA
page-top