Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig617
Contig Information
Length 539 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10b14    rwhkp10b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0941800 [Oryza sativa (japonica cultivar-group)] >gi|18844963|dbj|BAB85431.1| purple acid phosphatase-like [Oryza sativa Japonica Group] >gi|113534892|dbj|BAF07275.1| Os01g0941800 [Oryza sativa (japonica cultivar-group)] >gi|125529062|gb|EAY77176.1| hypothetical protein OsI_05146 [Oryza sativa Indica Group] >gi|125573280|gb|EAZ14795.1| hypothetical protein OsJ_004620 [Oryza sativa (japonica cultivar-group)] >gi|215741548|dbj|BAG98043.1| unnamed protein product [Oryza sativa Japonica Group]
Score 517
Evalue 4.55613e-51
Total Hit Count 143
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig617
CCAAAGTCCAAGACTGAGATCTGCAAGCCCTGCGTTGGTTCCCTCAACGAGGAGGATGTGGCGCCACAAGAAGCCGAATGGGGCATGATGGACGCTCTTG
CCAAGAGGTCTTCAGTTAAGGCGATCTTCGTGGGGCACAACCACGGGCTCGACTGGTGCTGCCCGTACGAGAAACTGTGGCTGTGTTTCGCGCGGCACAC
GGGTCACGGCGGATATGGTGACTGGCCAAGAGGGGCAAGGATCGTTGAGATAGCCGAGAAGCCGTTCTCTGTCCACTCCTGGATACGGATGGAGAACCGG
AGCACGCACAGCCATATTACATTGTCTTGAGCTTGATTCGGATAGGATTCAGAATCGTCTGCACCATGATGTGTTGAGTTCGGAAAGTCCACCAATATGC
AAACAGTTTGCAACTTTGTATTTGATTCAGTTAGGCTTTGGTGCAGGTGGCTCCAACGAATAATTTTGAGTTTGGCTCATGTTAGTGTCGTTATATCACA
GTATGAACTAAAATTACGACACTTATTGTAAAAAAAAAA
page-top