Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2036
Contig Information
Length 653 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 21 Clones [Download: CSV  ,  FASTA ]
whfl51m01    whfl11f18    whfl47g12    whfl39a02    whfl26e20    whfl10o04    whfl28o09    whfl6m12    whfl13a11    whfl16f07    whfl10d07    whfl34m09    whfl42h16    whfl18c03    whfl8d09    whfl43i18    whfl41m15    whfl41m04    whfl42f07    whfl33a23    whfl37o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191841 [Zea mays] >gi|194689986|gb|ACF79077.1| unknown [Zea mays]
Score 477
Evalue 1.36947e-75
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2036
ggaGGCCAAGAGTCTGTGCAAATTGCCACCCTTTTTTCTCCCTTTCCCATCCCCATCTTTCGTCCACCGCTCCCCGCCCCCTCCCCCCTCTCACCGCGGA
GCCCATCCGCCGCCCGCCGCCGCCGCCGTTGACACTACCCGCGAATCTCCTTCTTCCGAGTGGTGGAGAGGAGACATGGCACTCCGAAGGCTGCTTCAGG
GGATTGTCCTACCGCGGACGACGGGCCGGCATGTTGGGGCATCGTTTTCCACGGAGGCTGGGGAGACTATCCGCGCAACCCTGTTTCCCGGTGATGGCAT
CGGGCCTGAGATCGCCGAGTCGGTCAAGCAGGTATTCAATGTTGCAGGTGTACCTATAGAATGGGAAGAACATTATGTTGGGTACGGAAGTTGATCCCAG
AACAGAGAGCTTTTTGACATGGGAGAGCCTGGAGTCGGTGCGTAGAAACAAAGTTGGCTTGAAAGGTCCTATGGCTACACCTATTGGAAAAGGCCACCGT
TCTTTGAATCTTACATTAAGGAAAGAACTCGGACTCTACGCCAATGTCAGGCCTTGCAACAGCCTCCCAGGCTACAAGACTAGA*TATGATGATGTGAAC
CTTGTGACAATCCGTGAAAATACTGAAGGAGAGTATAGTGGCCTTGAGCatca
page-top