Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig559
Contig Information
Length 773 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp4f19    rwhkp4f19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L15 [Homo sapiens]
Score 856
Evalue 5.12657e-90
Total Hit Count 400
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig559
CTGCCGCCGCAGCCGCAGCCGCAGCCATGGGCGCGTACAAGTTCGTGTCGGAGCTATGGAGGAGGAAGCAGTCGGACGTGATGAGGTTCGTGCAGCGCGT
GCGTTGCTGGGAGTACAGGCAGCAGCCGGCCATCGTGCGCATCACCAGGCCCACCCGCCCCGACAGGGCTCGCCGTCTCGGCTTCAAGGCCAAGCAGGGG
TATGTGGTCTACCGTATCCGTGTCAGGCGTGGTGGCAGGAAGAGGCCAGTGCCCAAGGGTATTGTCTATGGTAAGCCCAAGCACCAGGGTATTACCCAGC
TCAAGTTCCAGAGGAACAAGAGGTCTGTTGCTGAAGAAAGAGCTGGGCGCAGGCTGGGTGGTCTTCGTGTGCTCAACTCCTACTGGGTGAATGAGGACTC
TACCTACAAGTACTTTGAGGTCATCCTTGTTGATGTTGCTCACAGTGCTGTCCGCAACGACCCAAGGATCAACTGGCTCTGCAAGCCCGTGCACAAGCAC
CGTGAGCTTCGCGGACTCACGTCGGCGGGAAAGAAATTCCGTGGTCTGCGTGGCAAGGGCCACCGCCACCACAAGAACAGGCCCTCAAGGAGAGCCACCT
GGAAGCGCAACCAGACCGTCTCCCTCCGCCGCTACCGTTAAGCTGCCCTATGCACACCTTGATAGTATTTTGTTTGAGCCATCAGGTTTTGCTACCTTCG
TTCTGAGACTACTTGAAGCTTGTGCTAGAACCTTTATGTCGAGGCATATCTGTTGAACTATTTGCTATCTGCC
page-top