Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig202
Contig Information
Length 514 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl10c18    whfl15b08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0498300 [Oryza sativa (japonica cultivar-group)] >gi|48475216|gb|AAT44285.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579499|dbj|BAF17862.1| Os05g0498300 [Oryza sativa (japonica cultivar-group)]
Score 714
Evalue 5.69649e-74
Total Hit Count 59
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig202
taGGGTTGGAGTGTCATACTATGATTCAAATACGCGCCAGCTTTTTGTATTGGAAATCTGGGAAGATAGCGCTGGAGGATTCCCTCTGATTGATCTTGTG
AAATGTCAAGCAAAACCAAGCACCATATATGCAAGTACAAAGACGGAAGAAGAACTTCTATCGGCTTTACAGAGAAATGATAGTAATGTTGACCCCCCTG
TTGTGAAGCTCATGAAAAGCTCAACATTCACCTATGAGCAAGCCTGGCACAGATTAATATACTTGAAAGTTGCAGCAATGGATGATGGATTAAGTGTAAA
AGAGAGGATTTGCTTTCTTAATTCCATGATGGATCTTGGAAGTGATGTTCAAGTTCGTGCTGCTGGAGGTCTTCTTGCTATATTAGATAGCGAGAGGCTT
CTTGATACCCTTGAAcaaatggaaggaggagcatccattgcaattgattctgtcacacagatctcattagacagattattgaaacttgatgcagctgctc
atgaggcactacag
page-top