Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig430
Contig Information
Length 673 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10b19    rwhkp10b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mCG120852 [Mus musculus]
Score 86
Evalue 0.744861
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig430
CGTGCGCGCTCGTGTGGCTGGGAGTGGACTGCATCCCACAAGCAGCAAAGGCTTTTTTTCTTTTCCTTTTGGATTTTGGATGTGCAGAACTGTTGCAGTT
CATTTGAATCTTTTTGAAGCTCACTGAATTTTATTTTGTAGTTCACCCATCCTCCGCTGCCGCATCCTATGCTAGCCGCCAGTGTGTGGGATGACGCTGG
ATGGGGGCGAAAAAAGTAAACTACGACTGAAACGCCTAAGAAGGTTCTAATGGCCTGAAGATCAAGCAGGTGATCTTATTCCTCCCTGCTAATGTCCATG
TGTCAGTGTCTTCCACCATCCTAGAGAGAGCCTGCACTGGTGTTGTCCGTTTGTTCTCAAAGAAAAATCACGATGAGGTACCTGTGCGAACAAAATAGGA
AAAACAAATCTCCCCGTATATGGATTGGTGGGTGAAAAAATGGGGCTGAGAACCAATACGGAGGGCATGAATTGTAGTAGTGAGATGGGATAACAGTGCA
TCCGTGCGGGCGTGCAGTTTGGCGGCACGGCGCGTGTGGTACACTGGTTCCGGTGATGCTGTTCGCCGGCGTACTCCAGAGTAACAGTTTCGCTTCGTGA
CGATGTCTTTGTTTGCAGTTCTCTAGATGTGTGTTGTAGTGCACTGAATAAAAAAGGTTTTGTAAAAAAAAAA
page-top