Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig417
Contig Information
Length 821 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10c11    rwhkp10c11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 877
Evalue 2.09848e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig417
GAAGAGAGAGCTTTCTCAGACAGACTCGACATATGATTCTGAGAAGCTGGCGGAGAGAATAGCAAAGCTCTCTGGCGGAGTTGCTGTGATCAAGGTTGGA
GCTGCAACAGAAACGGAGCTTGAGGACCGCAAGCTCCGCATAGAGGATGCCAAGAATGCCACTTTTGCAGCCATTGAGGAAGGTATAGTACCTGGAGGTG
GTGCGGCCTATGTTCACCTGTCGACTCTCGTACCAGCTATCAAGGAGAAGCTGGATGACCCTGAGGAGCGCCTTGGTGCTGATATCATTCAGAAGGCTCT
AGTGGCACCCGCATCGTTGATCGCGCACAATGCCGGAGTCGAAGGGGAGGTGATCGTGGAGAAAATCAAGGACAGCGAGTGGGAATTCGGCTACAACGCG
ATGACCGACAAGCACGAGAACCTGGTTGAGGCTGGCGTCATTGACCCAGCGAAGGTGACGAGGTGCGCCCTGCAGAACGCAGCGTCGGTGGCCGGAATGG
TCCTGACCACCCAGGCGATCGTCGTGGAGAAGCCGAGCAAGAAGGCTCCCGCGCCCGCCGGGATGCCCCAGGGCATGATGTAGAAGCGCAATGATATGTA
GCAACCTGGGGGCATGCAATTTTAGGGGCGTGTGGTGATCGTTTTGCCAGGGGAGAGAACCGTGGCACCTTAAGGAGGAAATCATGGTGTGTAATGGATA
ATGATGGCCTGTTCTATTGTCTGTTTGGCACGCTTCGTGGCGATTGCCATGTTGAAAACTATTTTGGCTANCTGAGTTTGANAANAANTAATAAATTANT
AAANTTGANGATGTGCCAAAA
page-top