Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2000
Contig Information
Length 623 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 20 Clones [Download: CSV  ,  FASTA ]
whfl44f19    whfl31b14    whfl12d17    whfl10b04    whfl3l11    whfl32e12    whfl47b14    whfl40m10    whfl37d01    whfl46n06    whfl52e21    whfl1a20    whfl51i15    whfl43a12    whfl4e16    whfl47b20    whfl35l23    whfl32k22    whfl45h02    whfl25l12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pre-mRNA-processing factor 17 [Schizosaccharomyces japonicus yFS275] >gi|211999960|gb|EEB05620.1| pre-mRNA-processing factor 17 [Schizosaccharomyces japonicus yFS275]
Score 85
Evalue 0.819721
Total Hit Count 8
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2000
atATAATTTGAGTCCCGTCGCCCTTGTTTCCCGTCCATCAGTTCCGAGTCCCCCCCACCCCCGAAAAAAAGATCAACCTAGGGTTAGGGTTGCGGCGGCG
GCGGCGGCGGCGGCATCAGCTTTATTCCCGATCCCGGTCGCCGTGTCCACCGGAGTCGCGCCAGAGCTGGAGGAGGAGACCGCCATGGCCACAGGAGTCG
CGCCAGAGCCGGAGAAGAAGACCGTCGTCTTCCCCGGTTGGGTGATGCTGGATCGCTTCGGCCGCACCTACTGCCACGGCGACCTAGACGCTGCTTGTGA
GGAGGCCAATAAGAAGAAGACCGCCGTTGAAGTCGTCACGTCCACCGGCCACCACTGCTTCATGTCATTCACCTTCTCGGATCATAAAGAAGGGATCTCT
TACCTCGATCTACACTGGCCGCTGGAAGGCTCAGCCAAATCCGAGTCCCCCTTCAGCGTCCACGCATATCCCTACCTCCGGGCAACCGACAAGGACCTCG
TCCTCTTCGACATCTCCCTCCCGAGCCAGACTAGCTTCTTCGACCTGCCGCCAGATCTGTTCGTCTACACGGCCGCCGGTCCTTCCCCCTGGggtGCAGC
GGCTCCCTCTGTACATTGAGgac
page-top