Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig2
Contig Information
Length 739 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhfl38j21   
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 811
Evalue 7.82896e-85
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig2
ggtctcataacatccaggtttcaccaaagcttacattaggacagtatgtaaggcacaagacagacaccaccaagggcacgatatgcagcgctaacagctg
aacagctaaaatatacccagtacgaacaatgcccttaacaaaactcagccaatactaaaaactgcttggtgtctgaaacagtgatttggatatcaattgt
ggaattacttcttcttgatggcagccttggtcaccttggccccggttgggtccttcttctcaacgcccttgatgacaccaacagccacagtctgcctcat
gtcacggacagcaaaacgaccaagaggagggtaagtggcaaaggtctccacaaccatgggcttggtgggaatcatcttcactatgccagcatcaccattc
ttgaggaacttgggcagggcctccagctccttaccagaccgcctgtcgatcttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagt
ccagcactggggcgtagccgttgccaatctgaccagggtggttcatgatgatgacctgggaggtgaagttgtcaccaggaagcgcctccaggagagactc
atggtgcatctcaacggacttgacctcagttgtcagaccagtgggaccaaaggtaacaaccataccaggcttgatgacaccagcctcaacacggccaaca
ggcacagttccaatgccaccaatcttgtaaacatcctgt
page-top