Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig205
Contig Information
Length 622 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10c02    rwhkp10c02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_89036 [Branchiostoma floridae] >gi|210105912|gb|EEA53915.1| hypothetical protein BRAFLDRAFT_89036 [Branchiostoma floridae]
Score 110
Evalue 0.00103455
Total Hit Count 306
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig205
AGCCCCCAAGGGTCTCACCGCCGGCGTACAAGCCAGCCCCCAAGGTCTCACCACCGGCGTACAAGCCCGCCCCCAAGGTCTCACCGCCGGCGTACAAGCC
AGCCCCCAAGGTCTCACCGCCGGCGTACAAGCCCGCCCCCAAGGTCTCACCTCCGGCGTACAAGCCTGTCCCCAAGCCCTCACCGCCGCCGTCGCCAACT
CCGCCGGCGCCGAAGCCGACTCCACCGCCCTACAAGCCCCCGACGCCTACTCCTCCGGCGTACAAGCCTCCCACCCCGAGCCCCCCGCCTCCGCCGTACC
ACCACTAAGAAGATCCACCACTGTCAAGCTGGGAGCCTAGGATGCGGTCGAGAAGAGTTGTGCGAGCAGGCCAAGAAGAGCCACGTACGTACGGCGTCGT
TGATCCTCCTGCGGTGTGTGAGTTGCTGCCGAGCTACTAGGGCCGATCTCTGAGGAGATGGAATAATGCAGATGGCTCCCATTAGTTATCTTACCAGCTT
ATCATTTGTGTTCGTCCAGTGTTAGCGTCTGTGTTGCTAGTGTCGCAATGTTGCCAGTGTCACTGTAAAACCATTAATCACCACGGAAATGGAAGTTAAA
GGTGTTGTTTCCAAAAAAAAAA
page-top