Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig187
Contig Information
Length 1065 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10c09    rwhkp10c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to nephrin [Strongylocentrotus purpuratus]
Score 83
Evalue 3.78079
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig187
CGTGAGCGAACCCTCGGGAAAGGGCGAGAGAGAGAGCAGTCGCGGTCTCGACGACGTGTCGGTCGCTCCACTCAAAGCGGCGAGGGGTTGTCTCGTCCCT
CATGCCGTGACATGAACCATCAGATCTTGAAATCGACGGCTCGGATGCAAGTCAAAGCCATCTGTTGTGTAGCCAGCAGCCAGCACTAACCGAAAAAAAT
GCGTCTCCGCGGTCACGATTTCCGGGGAGGCGTCTCACATGCGTTTTGGGACTGGCATTTTTGAGATAAGATCAGGAAATGTTGGTGGTAGTATAGAAAT
AGGCTTTCGTTTCTTTAGATTAGATTCCTTCGGGACGACGCAACCTGGGAATCGGGAATTAATATTTCCGTTGACGACGCGGTACTACTACCAAAGAACG
GCTATCCTCTGACCCAAGATTATCAACCAGCTTTATTGCAGTACTAATTACGTAGATGCTCACGCACTAACTGTTTATACTCTCACGAAGAACGGCTCTC
CTCTCACCGGAGATTCTTGATCAGCTTGATTACAGTACTAATTATGTTGATGCTCGCGCACTAACTGTCAGTATATACTAGTGTCAGAAACGTTCTTATA
TTATGGGATGGATGCATGCATGGTTGAGCATTTCGAATTCGCATAATGTTTCATTATGCCGGCCATAGGCATATACCTGTTGCAAATGCTGTCAGTATAT
TATGCAGCTACTTTATCCTGCCTTGGATGTTGTGTCTCATGATTCCCTCGTGATATTTTGTTTGCGACAGCCTGGCCGCCCCTTTGCTGCTGCTGTCTCC
TGGACGCCTGCTTCTGAGGAGGGAGGGAGGGAGGAAGACGACGATCAACTTCGTGCAACTGGGACTGAGCTATCCTTCTCTGACGGAGAAATGCTGCTAG
TAGCTTAATTATTATTTCTCGTCGGGCATTATCGCCTCCTTTGTTTGATCCATGTTTATGAACCTCTCTGCATTGCAACTATTCGCTTGGTTGTCGACTG
ATGATTATGTTATGCCTGGTGCCTTCCGTGTGTATACTGTGTCGGTTTATCCGTCTCTGGTGGTG
page-top