Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1993
Contig Information
Length 437 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 19 Clones [Download: CSV  ,  FASTA ]
whfl12k07    whfl44l07    whfl54d04    rwhfl39p22    rwhfl43d07    rwhfl44c06    rwhfl44l07    rwhfl43d08    rwhfl51h15    rwhfl54d04    rwhfl10h10    rwhfl17h10    rwhfl12k08    rwhfl11l20    rwhfl44c17    rwhfl12k07    rwhfl13f15    whfl44c17    whfl10h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 154
Evalue 4.12529e-09
Total Hit Count 14
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1993
ttttttttttgAATGAGACCAAATTATATCTCATCTAGATAAGTTCTAGGTACTCCCACAAAGAAGCACACCTAACTAAAACAACTTGTTCAACCTGCGC
AATCCCGGTACACATCAAGCACCAGACCATACTCCTAGATTGGTCGAGAAAATGCTGCTTGCCCTGGCTGAGTGGCTGCTCAATTGATCATCTTCTGAAG
CTGAAGCTGCTCTTGGCGCCCGGCACCACGAGGCTGCCCAGAGTCCTGGCGATCTGCAGCTTGAGCTGGCCTCTCTTGAGCGGAGGCCTCTTCTCCTTGT
TGCGGCTGCAGCTGTTGCAGGGGGACCCGTACTCCATTGCTCCGCTCTTCCTTGCTTGTCTTCCTCCTCTCCGCGCTTGAGATTCTAGCGGTGGCTTGTG
TTGCTGAGGAAGGCGAGGGAGAatggttttcggttct
page-top