Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig161
Contig Information
Length 984 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10c05    rwhkp10c05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0608300 [Oryza sativa (japonica cultivar-group)] >gi|34395138|dbj|BAC84852.1| putative membrane protein [Oryza sativa Japonica Group] >gi|113611777|dbj|BAF22155.1| Os07g0608300 [Oryza sativa (japonica cultivar-group)] >gi|215741071|dbj|BAG97566.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199997|gb|EEC82424.1| hypothetical protein OsI_26818 [Oryza sativa Indica Group]
Score 944
Evalue 4.85123e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig161
ATTGTCCCAACTCTCCTAGTGTCATCCACAACTATCAATGCTCAGGTTCAAAGGTCTAACAAACTTTGATCATGTTTGTAGGTATGGTGAGAGCGAAGGT
TATCCTTCTCAGAGTGGCATCACAAAAGATGCACAGGCCGCACTTGATCATCTACTTCAGAGGAAGGACATTGACACATCCAGGATAGTTATCTTCGGGA
GATCTTTAGGAGGTGCTGTTGGAGCAGTTCTTGCAAAAAACAATCCTGACAAGGTGTCTGCTCTAATATTGGAAAATACTTTTACATCTATATTGGATAT
GGCTGGTATCATGCTGCCCTTCTTAAGATGGTTCATAGGCGGTAGTTCTGCCAAAGGCCCAAAACTTCTTAACTGCGTTGTTCGCTCTCCATGGAGTACA
CTTGATGTTGTTGCAGAGGTCAAACAGCCCATTCTCTTTCTTTCTGGATTGCAAGATGAACTGGTTCCCCCTTCACACATGAGGATGCTGTATGACAAAG
CTGTTGAACATAACAGGAATTGTAGGTTTGTTGATTTTCTCAATGGTATGCATATGGATACCTGGATTTCTGGAGGGGACCGCTACTGGAGGACAATCGA
ATTGTTTCTGGACCAATATTCCCCAGAAGTACAGAGTTCTGATGCCAGCTGCACAAGTGAAATTGCTGATGATGATAAAGCTGCATAATAATTGGAACAT
CTAGAGCAGCCTGCTGTTTTCCACCAGTTTTTCTGATGTTGATGCAATTCCGGTCTTTGATGGATTGAAGATCATTTCAAACAATTAATTCAGGTGGTTG
TTCTGCTCCATTCCACCTGAAGAAGCCAAAGCTGTGAATATATTTTGAGGTTGTTCTCCATCCTGTGATGCTGCTGCATATGTGTATGGAATGACACATA
TATATTTCTGAGCCTGGCTCGGCCTTCAACTCCCGAGTTTCTGTACAATGTTGAATTGGCTTCATTCAAGTATTGCAATTATGA
page-top