Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig141
Contig Information
Length 525 bp
Tissue Shoot grown under continuous light
Clones 2 Clones [Download: CSV  ,  FASTA ]
whkp10e05    rwhkp10e05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12417 [Oryza sativa Indica Group]
Score 98
Evalue 0.0162309
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig141
TGGACCTAGAGGTGCACCGCCGCATCCTCCTTGGGCATCCCCCAGCGAACCGAGAACCGCGATGGGCCAGCCTGCCTGAAGAATGGGTGTCCGGCGGACG
GAGGAGCGTATACCGACCGCGGATGCCTCAAGAAGTACGGCTGCTCGTTAACGCCACCACAGTCCACAGTGAACTGAAGGGCACTACGTACGGGCGTCAA
TGCAACCTCCTTCCTGCACGCCGTCCGTTCATGGGCGCACTCGCGTTCCATCCATCCATCCATGTTTTATTTCCTTTCCATTTTGCATTTCAGTATCGTC
GTTGCTAACTTTTCTGTCGGCATGTACGTACCTTGAAATGACTTGGTATTCCGTACTACGTAGAGTTGGCATGATTGTGCAAGCGACACGGTTGTACCAT
CCGGCTGATGGTCGATACTATAGTTGATGTTATCTTACGTCCAGTTTGCACTTAAACACAAGTAAAAACAATTTGTACATCTCCTTGGAATAAGATCTCA
CTGCATTTGGATTCCAAAAAAAAAA
page-top