Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1987
Contig Information
Length 620 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 19 Clones [Download: CSV  ,  FASTA ]
whfl47m06    whfl42o15    whfl39d15    whfl48h05    whfl9g08    whfl10e04    whfl47b21    whfl55a04    whfl18c12    whfl32a23    whfl44h14    whfl50d14    whfl14l08    whfl50h05    whfl42o16    whfl9g19    whfl30p08    whfl39h06    whfl13e02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10473 [Oryza sativa Indica Group]
Score 518
Evalue 4.99853e-51
Total Hit Count 123
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1987
tcgaattcgtcgagtgCTCTGGTCCTGCGCGCTGGACCGGAGCGCTCGCCTGCCTTCCGGAAGGGGGAAAGTGGGACTGAGAGAGAGCACACCAGAACCA
GATGGCCCCGCTCGCCGCCCGTCGGTAGCCCCGGGCAGACATTGCCGTCTCCCTCTTCCTCCTCCCCGGACAAGAAGTAGAAGCCGCCGGGGGCAATGAG
GAAGCACGGGTGGCAGCTGCCGTACCACCCGCTGCAGGTGGTGGCGATAGCCGTCTTCGCCGCGCTGGGCTTCGCCTTCTACGTCTTCTTCCTGCCCTTC
GTCGGCAGCCAGACCTCCCAGTACGTCGCCATGGGCCTCTACACCCCGCTGATTACGTGCGTCGTCACGCTCTACATTTGGTGCGCCGCCACGAACCCCG
GCGACCCCGGCATCTGCAAGTCGGCCAAGCTGCACTCGAGGATGGACAAGGA*CGGG*CGGCAGTCCCACTCCCACATGGATTCGGACCACGGCCTGAAT
GCCGCTGACAACAGCGAGAAGCTGAGCAGCATGCTCGAGAGGAAGGACTCGCCTTCTTGGCCcagatGCTCTCAACTGCTCTGCTTAGTCTGCTTGCCCT
TTTCCTGCCTCTGcaaaaga
page-top