Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1980
Contig Information
Length 763 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 19 Clones [Download: CSV  ,  FASTA ]
whfl7k05    whfl8k04    whfl14l09    whfl9n07    whfl10l09    whfl9j04    whfl9l09    whfl7j05    whfl10k04    whfl10c03    whfl11k10    whfl11l09    whfl10i06    whfl12l09    whfl11g04    whfl11k03    whfl10k09    whfl12g04    whfl11l03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasmid partition protein A [Escherichia coli O157:H7 str. EC4045] >gi|209395633|ref|YP_002268427.1| plasmid partition protein A [Escherichia coli O157:H7 str. EC4115] >gi|208730559|gb|EDZ79258.1| plasmid partition protein A [Escherichia coli O157:H7 str. EC4045] >gi|209157088|gb|ACI34522.1| plasmid partition protein A [Escherichia coli O157:H7 str. EC4115]
Score 852
Evalue 1.44387e-89
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1980
tgcctgcaggtcccgactggccaTTGAAACTGTTGCTCATGACTATGATGTCATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTC
GTATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACTACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGA
ACGTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATACAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCG
GGATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAAGTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAG*GCCAT
TGATCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAACCTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAG
ATTAGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAACCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGA
TTCGTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGCCTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGT
GATAGTgttgagaagacctctcgggtatggtcaggtaatgaacgtgaccaggagctgcttact
page-top