Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig12
Contig Information
Length 866 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp4a18   
Homology (BLAST) Top Hit Unknown (protein for MGC:35458) [Homo sapiens]
Score 861
Evalue 1.64643e-90
Total Hit Count 171
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig12
GGCACCCACGAGGCCGTCCTCAGCTCCTACGAGTACGTCAGCCAGGGACTCAAGAAGTACGACTTCGACAACACCATGGGAGGCTTCTACATCGCTCCTG
CTTTCATGGACAAGCTTGTTGTCCATCTCTCCNAGAACTTCATGACCCTGCCCAACATCAAGATCCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCA
AGGAAAATCATTCCAGTGCGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGTGGCAACGCCGGAGAGCCA
GCCAAGCTCATCAGGCATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACTGGTAACGATTTCTCGACGTTGTACGCCCCTCTGATCCGT
GATGGCCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCCG
TCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCTC
TACCGGTATCGAGAACATTGGCAAGAGGCTGGTGAACTCGCGGGACGGACCCGTGACCTTTGAGCAGCCAAAGATGACAGTGGAGAAGCTGCTANAGTAC
GGGCACATGCTTGTCCAGGAGCANGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCANGATGCGA
TGAANACTGGTTCCTTCTACGGTTANAACATTCTCCATACACACCCACCATCTCTTGCTGCATAGG
page-top