Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig11
Contig Information
Length 818 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp2o02   
Homology (BLAST) Top Hit Shaggy-like kinase [Triticum aestivum]
Score 960
Evalue 4.94756e-102
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig11
CTTCTCTAGACATATTACAGATCAGCCATGGCAATCCCAATTCTCAGGCGAGGGTTAGTACAAGGGAGGATGAACCGGTTACATTGTCAAGCTTGCATCG
CAGCATACTACTACTCAGCTACACAGGTCAACAGGGTGGAGTGGTCATACATCACGTCTTCCAACAACCATAATAGTTCATCATGCTCGCATGCTGCCCA
ACCAACATCCCCAGGGGAAATGTGGCACTTGTCGATGCAATTCCAACGACTCGTGCGACAAGCATCTCATAGTCACGCATGGGAGCTCTGCTTTCTCGCA
TGATCTGGGATCAATTTTGCCGCAACATCCGCTGGGATTCCTTTCAGTTCGTTAGGCTTGAAGTTAAAAAGAGGAGGCAGAAAGCGGCTATTCGGAAGGC
GGGTACCCGGGTCCCGAAGCTCATCAAAGAAGGGGTGAACAAGTGCCTCAACAGCAGTGCATCTTAGGTTGGGCGAGTACTGGAGGAGCCGAGAGACTAG
ATCAACAGCTTCAGGTGGCATCCTTTTATGGAATACCTTGTGCCATGGGTGTGCTTTAATCTGTGGGAATTTGAACTCTGTATAATTTGGGTTCATGCAT
TTAATTTCTTCCCTTGTAGGGGTACCAAGGACCTTGATGATTTCAACAAGCTGGTCCACACCACTTTCACCAGGAAACAGAGGCTGCCCTAGCATAAGCT
CAGCAAGAACACATCCAGCAGACCAAATGTCAATGGCTGTAGTGTACTCAGTAGCACCAAATATGAGCTCTGGAGCCCTATAGTATCGGGAACAAATGTA
TGATATGTTTGGTTCTCC
page-top