Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig10
Contig Information
Length 762 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp20g20   
Homology (BLAST) Top Hit RecName: Full=Endoplasmin homolog; AltName: Full=GRP94 homolog; Flags: Precursor >gi|22652|emb|CAA48143.1| GRP94 homologue [Hordeum vulgare]
Score 314
Evalue 3.50101e-27
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig10
AAAGATTGATATCTTATTCCTCTAATCTAGAATGGGGCCAACTCCAGCAAATAATCAATCCACTTCTGTTCCAGTCTAAAATCAACTTCAGCAGCACAAA
CTTCCAAGTGAAACTCGCTCCTGTTTTGAGATACACGCTTGCCGCCAGACTACCTTCGTAACCCCATTATTCCATTATTAATTTCTGTAACTACGTACAC
CACTGCCAGGAAACCAAAACAGCAAGTATACAAAAGGGCGCTTCGTACTGAAAGTCTGAAACCAGGCATGCTAATTTGAACTAGCTAAGGTATCATTAAA
CAAAAACTAGGTACAGTACATTACACGGACAAAAACCTCGTATCACCACGATGATTTGCGTTTTCGCGCGGTAAAAATGGACGTCCCTCGAAACCATCAC
ATTTCCAGTCCAACATTTCTAGTGAGAGCTAAATGGGCGATGAAGACATCAGCAACTACAGCTCGTCCTTGTCGTACTGCTCGTGCTCCGGCTCCTCCGC
CCTGCCCGACTCCTTCTCCTCCACCTCGGGCTCCTCCACCTCCTCTTCCTCCTCCACGGNCGCGTCGGGGCTAAGGTCCAGGCTCTTCTGCACCGACCGG
TAGATGCTCGACGCAAAGTCCTTGGGGTCAGGAAGGTTGAACCCGCTCTCCATCANCGCCGTCTGGTACACCANCCTCGCCGTCTGCTTNNNGCCCTCNC
TATCGCTGNCCTGGGNAANCTTGTCGCGGANCTCCTTGATGATGGGGGNGCCNGGGGNNGAT
page-top