Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig5
Contig Information
Length 690 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp18o07   
Homology (BLAST) Top Hit AFR668Wp [Ashbya gossypii ATCC 10895] >gi|44985327|gb|AAS54040.1| AFR668Wp [Ashbya gossypii ATCC 10895]
Score 79
Evalue 5.19145
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig5
ACTATCATCTAATAAATAAAACCAACAGCTGTGCCATAATTTGTGAAACAAGGTCCACAAAATAAAAAATAAAAAATTATGTACAAACCAATGAACCAAA
TCGATGTAATGTTTAAGCTACAACAGTAGCATAACTGTTCAAATTGCGACTTAATGAATGATTTTCCAGATTAGTAGGTACATCTGACTTAATAAATGAT
TTTCCAGATTAGTAGGTACATCTGACTTAATAAATGATTTTCCAGATTAGTAGGTACTTCTGACGATCCTGCCGGTGGAAATTCACGGTCACAGATTTGT
CCAGAATCAAATAGCTCTTCACGTCTCTTCAGCCATCGAAGCTCCAACGAGAGAAACATCCATTCGACGGTGCAGCGATAATTGTACTGTAAGCTTCATT
TGGGTAATACACGGACCACTTACAGCTGTTCAAGCTTTGGTCTTTCGAGGGTAGCTCCATGAACGATTTGCGACGGTAGAACGTTGTGCCATGTAGTCGG
ATCGGACGAGGGGTGCGGACAAAGGAGCACACCAGCACACAGGGGGGAGAACCCGGGGCTNNNNCNNNATANCCCCCGNGCGATCTCCCCCCNANACNNN
NNNNCNTCTNNATTATGGNGGNNNNCTGNCNTGCNANCNCNNNCNNNNNGNNNNNNGNNNCNNNANNNNNNNNNNNCNNNNNNNNNNNNC
page-top