Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig4
Contig Information
Length 381 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp18d05   
Homology (BLAST) Top Hit hypothetical protein OsI_33098 [Oryza sativa Indica Group]
Score 142
Evalue 1.02899e-07
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig4
ACATAATTAAGCACAACCACGTACGTTACAGATAATAAAATACAGAAGGAACGCAGCGCACAAACTTAGCAAGAGCAACATGCATGTAGATGCAGAAACC
AGACTTCTACTTCATGAACCCCTGAGCCATCTTCATGAACCCGCCGCCGCCGCCGCTCTCCTTCTCATCCTCGCCACTCTTCTTCCCGGACAGCGATGCA
GCCCCCTTCATGACGTCGTCGAGACCGAACCCACCGGACGCTTTCTCTTCCTCCGCGGCGGGTGCAGGTGCGTCAGTTTTCTCCTTCTCGGTGCCGCNGG
AGCTGTACTGTTTCAGGTACCCTTCAGCCTTCTCGAGGTACTGCCCCACCGGCTTGTCCTCCNGCTTGCCGTANTTGGNGG
page-top