Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig3
Contig Information
Length 725 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp4i22   
Homology (BLAST) Top Hit biogenesis protein [Hordeum vulgare subsp. vulgare]
Score 703
Evalue 2.4987e-72
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig3
CTTTTTCTCCACTCTCCTCTGCTCGACAACATCCCGCCCTCCCGCCATGCTCTCCNTCNCCATGAGCACCCGCCCCGATGGTCTCCCGCCGCCCACACCT
CCCAGCGCGAGCTGCTAACCCCACCCCATCCTCCTCGCCTACGACAGAGACTCGTGGAGCCANGCCGGGGGCCGTGGTGAGGCGGTCGCTCCTCCGCCCG
CGCCCGATCGTGCTGTCATGTGTAGCCGTGGGAAGTCTGGNTGCTGCTGGGGCTGCAAATGCTGCCGACCTCGGGGATTCTCTGGTTGTTGGAAATTCAG
TTGCTTTCTCATTAGGACTGGCAACAACCTTAGCCATCCTTGGTGTTGCTGCTTCTTTTGCTGGAAAGGCTTATGGGCAAGTAGGACAAGGACTCCCAGT
GGCTGCTTCTGGGTTAGGAATCGTCATGGGACTGAACCTACTTGAGGTANTTGAGCTACAACTTCCCTCATTTTTCAGCGATTATGATCCTCGAGCTGCT
GCAGCTAACTTGCCTTCCAGTGTACAAGCATATCTTGCTGGCCTTACATTTGCATTAGCAGCATCACCTTGCAGTACACCTGTTCTTGCTACCCTTCTGG
GATATGTTGCCACTTCAAGAGATCCAATTGTTGGGGGAAGTTTGTTGTTGACATATACAACTGGCTATGTTGCACCTCTTCTCATTGCAGCCTCTTTTGC
TGGAGCATTGCAGAGTTTGCTGTCA
page-top