Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig2
Contig Information
Length 627 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhkp7i07   
Homology (BLAST) Top Hit flavonoid O-methyltransferase [Triticum aestivum]
Score 469
Evalue 2.46521e-45
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig2
GCACTTTAGAGCAGCACTATTAATACAGGAGTACATTTCGAATAGATCGACGACACAACCAGTAGAATTCAGAAAGATTCAGAGCTAGCATGACAACAAA
ATTAGGAAAACAGAACAAACACCAAGCCGAAGTACATATGCAGCAGGTTGATGCAGCAGCGCCGGCGAGCAAGAAGACGACGATCTCAAAGCGAGCGGTG
GACGGTTGGCATGCATGGATCTACTTGGTGAACTCGATGGCGAATGCGTTGGCGTAGATGTAGGTGGTCTTGATGGCGGCGAAGCCGGCGCCCTTGGCCA
GGGCCTCGAACTCCCTCTCGTACCTCTCCCTGCCGCCGGGGTTGTGCTCGTCGCTCCAGTCGTGGAGGATCCACTTCATGAGGATGGCGTCCCCCGAGGG
CACCTTCTGGAACATGTCGCCGCCGACGTGGGTGACGCCCGGGAACGGCGGCGCCTCGGAGATGACGTGGGGGAGGTCGAAGTTGATGCCCTTGATGGCC
GGGTACGCGGCGACGATGGCGCCCACGGTGGCGCCCACNCCGCCGCCCACNTCNACNATGGTGCCGANGNCCTCGAAGCCCTTGTANANCTCNANCANCT
TCTTGNTGATGATGATGNANTGNNTCT
page-top