Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_KMP_all.Contig1
Contig Information
Length 739 bp
Tissue Shoot grown under continuous light
Clones 1 Clones [Download: CSV  ,  FASTA ]
whkp1f11   
Homology (BLAST) Top Hit proline-rich protein [Zea mays] >gi|6689616|emb|CAB65536.1| proline-rich protein [Zea mays]
Score 387
Evalue 1.14634e-35
Total Hit Count 78
Registered year 2003
Contig Sequence     [ Download ]
>Wh_KMP_all.Contig1
AGTGGTAGAGGTTCAGGCATGGCAGCTCCGAGAGCGCTCGTCCTCGCCGTCCTGCTCGTGATTGCCATCGCCAACGCGGAGGCGACGTCGGTGGTCATCG
GCCTGGCCAAGTGCGCCGACTGCACCAGGAAGAACATGAAGGCCGAGGAAGCCTTCAAGGGTCTACAGGTGGCGATCAAGTGCAAGAACGTCGACGGCGA
GTACGAGAGCAAGGCGGTGGGTTCCCTCGACGGCACCGGCGCCTTCAGCGTGCCCCTCGCTTCTGACCTCCATGGCGCCGACTGCGTGGCTCAGCTCCAC
AGCGCCGCATCCAACGCGCCGTGCCCCGGCCAGGAGCCATCCGTGGCGTCGCCCGAGTGTGCGTCCATGATCCTGTGCGGGCCGATCAAGAAGCACATCA
TCGAGCACTTCCACCACAAGAAGCCGGTGCCACCGAAACCGGAGCCCAAGCCCCAGCCTCACCCGGACTACCACCCCGTGCCCAAGCCGGAGCCGAAGCC
GCAGCCCCACCCAGACTACCACCCCGTCCCTCCCATGCCCACCTACGGCGGCGGCGGTGGCGGTGGATACCACGGACACCACTGACTCCAAAGATCCAGT
CTACCACCCACCCGCCCAGCACTGAAGTCCCCATGGTTTCGTGCTCTGAGTGACGTTGCTATTTATGATCGCCGCATGCACAGTTGGTTTGGCCTTTTAT
TATTCCCCTACCCCGTTTTCCAGTATTTGCAGAATGAGT
page-top