Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2303
Contig Information
Length 1608 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 21 Clones [Download: CSV  ,  FASTA ]
whhg2e20    whhg4f09    whhg4j15    whhg6j01    whhg6l10    whhg10d17    whhg11j22    whhg16f20    whhg19l08    whhg12j11    whhg12o24    whhg8f16    rwhhg2e20    rwhhg4f09    rwhhg4j15    rwhhg6l10    rwhhg7l13    rwhhg11j22    rwhhg12o24    rwhhg14h07    rwhhg19l08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative AdoMet synthase 3 [Hordeum vulgare subsp. vulgare]
Score 1967
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2303
CCGCATTCCGCCTCTTCCCTCCCTCCTTCGGTTCCTCGGCCTCCCGATCGAGCAGTAGAAGCAGCGCAAGGGCACCGCTAGCACTAAAGGAATGGCGGCC
GAGACGTTCCTCTTCACGTCCGAGTCTGTGAATGAGGGCCATCCCGACAAGCTCTGTGACCAGGTCTCCGACGCCGTCTTGGATGCCTGCTTGGCGCAGG
ATGCCGACAGCAAGGTTGCCTGCGAGACTGTCACCAAGACCAACATGGTCATGGTCTTGGGCGAGATCACCACTAAGGCCACCGTCGACTACGAGAAGAT
CGTGCGCGACACCTGCCGCAACATCGGCTTCATCTCTGATGATGTTGGTCTCGACGCCGACCGTTGCAAGGTGCTCGTCAACATCGAGCAGCAGTCCCCT
GACATTGCCCAGGGTGTTCACGGACACTTCACCAAGCGTCCCGAAGAGGTCGGCGCCGGTGACCAGGGCATCATGTTCGGCTATGCCACCGATGAGACCC
CTGAGCTGATGCCCCTCAGCCACGTGCTTGCCACCAAGCTTGGAGCTCGCCTCACGGAGGTCCGCAAGAATGGCACCTGCGCCTGGGTCAGGCCTGACGG
AAAGACCCAGGTCACAGTCGAGTACCTAAACGAGGATGGTGCCATGGTACCTGTTCGTGTGCACACCGTCCTCATCTCCACCCAGCACGACGAGACCGTC
ACCAACGACGAGATTGCTGCGGACCTCAAGGAGCATGTCATCAAGCCGGTGATCCCCGCAAAGTACCTCGATGAGAACACCATCTTCCACCTGAACCCGT
CTGGCCGCTTCGTCATCGGCGGCCCCCATGGTGACGCCGGTCTCACCGGCCGCAAGATCATCATCGACACCTATGGTGGCTGGGGAGCCCACGGCGGCGG
TGCCTTCTCTGGCAAGGACCCAACCAAGGTCGACCGCAGTGGCGCCTACATTGCCAGGCAGGCCGCCAAGAGCATCATCGCCAGCGGCCTCGCACGCCGC
TGCATTGTGCAGATCTCATACGCCATCGGTGTGCCTGAGCCTTTGTCTGTGTTCGTCGACTCCTACGGCACCGGCAAGATCCCCGACAGGGAGATCCTCA
AGCTCGTGAAGGAGAACTTTGACTTCAGGCCCGGGATGATCAGCATCAACCTGGACTTGAAGAAAGGTGGAAACAGGTTCATCAAGACCGCTGCTTACGG
TCACTTTGGCCGTGATGATGCCGACTTCACCTGGGAGGTGGTGAAGCCCCTCAAGTTCGACAAGGCATCTGCCTAAGAGCATGGCATTCTCTTGGTCTGC
CGCCTCTCAAGTTCGTCAAGACGGGATCATGTTGCTCCTGGGAAGTGGGAAGAAGCATTAGACATTGAAGCGACGCTCTACACTGGTCTTGTTGTATGGT
AGTCAGTGCTAAGTTTCTTAATGTCATTTCATATATTTATCCTTTCCATTTTGAGTCGCTGAAACTGCTGAGTGATGTGCAGTTTGCTCTGTTAGTCGCT
CTGTCACTTTCACTTTTCATATTCTTTGTTGTGTAGTTCCTCATACTGCTCTTTCTTCCTGAGTCTCGGAAAGAATAATAAAGAGCCATGTGTAATTCAA
AAAAAAAA
page-top