Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2251
Contig Information
Length 1045 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whhg10h20    whhg16p12    whhg20b10    whhg14i03    whhg1f22    rwhhg1f22    rwhhg10h20    rwhhg14i03    rwhhg16p12    rwhhg20b10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1255
Evalue 4.61631e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2251
TATTGCTGATATATGTTCAGTAGCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGAGGAAACACAGTAGCAGCTGCTCCACCACAAAATTA
CTAGCATAGTACACATAATAAACACAGGAGAGAAAAAAAGGAGTCTCTTCATCTTCGCTGTCTTACTCCACGCCGAAAGGAGCCACGTCGAGATCTTGCT
TAGGCAGACTTCACGGTGGCGGCGTTGATGATGTCGATGAACTCAGGCTTCAAGGAAGCTCCACCAACGAGGAAACCATCGACGTCGGGCTGCGCGGCCA
ACTCCTTGCAGCTTGCGCCAGTTACAGATCCTCCATAGATGATCCGCGTGGATTCAGCAACCTCGGGGCTCACATTGGTCTTGAGCCAGTCCCTCAGATT
GGCATGGACTTCCTGTGCCTGAGCCGGTGATGCAACTTTACCGGTGCCAATGGCCCACACTGGTTCATAGGCGACGACCACGTTGGTCCAGTCCTTGATC
TTGTCAGCAATTGCTTTTGTCTGTTCAGCGACAACCGCCATGGTTGATCCAGCTTCTCGCTGCTCAAGAGTCTCACCAACACATGCAATGACCTTCAAGC
CCTGAGCGAGTGCATATGCAACCTTCTCTCCAACAAACTCGCTTGATTCTCCCATCAAGCTCCTCCTTTCAGAGTGTCCAAGGATGACCCAGGGAACGCC
GAGGTTGACAAGCATCTCAGCACTGACTTCACCGGTGAAAGCACCGCCCTTCTTCACCCAGCAGTTCTGAGCAGCAACTTGGATCTCTGGGCGCAGCTTA
CCCTTGACGGTGGGAAGGAAGACATAGGGCGGGCTAACGACAACCTCGACAACATCCGTAGAGGCGATCTGTCCAGCGTTCAGAGTATTGACGATGCTCT
CTACCTGTTCGACAGTTCCATTGCATTTCCAGTTGCCGCCGACGAAGAACTTGCGGCCCATGGCGACGGAGGAGGAGGGGGGAGATCGGATCGGGTTGGG
ACGGGCGGACGGGAGAGGGGGGCTCGAGATTGGATTTGGTGGCGT
page-top