Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2232
Contig Information
Length 1297 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 9 Clones [Download: CSV  ,  FASTA ]
whhg2h16    whhg4h16    whhg10c09    whhg10o21    whhg20c12    whhg20j03    whhg9i06    rwhhg9i06    rwhhg10o21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1058
Evalue 1.97203e-176
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2232
TTCTCCCGTCCCGTCCCGTCCCCAGCCAACCTCCCATCTCCGTCTCGCGTCGCGGCGGCAGTTCCACTCCCTCGCCATGGGCAAGATTAAGATCGGAATC
AACGGTTTCGGAAGGATCGGGAGGCTCGTCGCCAGGGTAGCCCTCCAGAGCGACGATGTCGAGCTCGTCGCCGTCAACGACCCCTTCATCACCACCGAGT
ACATGACCTACATGTTCAAGTACGACACCGTTCACGGCCACTGGAAGCACAGTGACATCAAGCTCAAGGACGACAAGACTCTGCTCTTTGGCGAGAAGCC
AGTTACCGTCTTCGGCGTCAGGAACCCTGAGGAGATCCCGTGGGGTGAGGCTGGTGCCGATTACGTTGTGGAGTCCACCGGTGTCTTCACTGACAAGGAC
AAGGCCGCTGCTCACTTGAAGGGTGGTGCCAAGAAGGTGGTCATCTCTGCCCCAAGCAAAGATGCCCCCTATGTTTGTGGTTGGTGTCAATGAGGACAAG
TACACCTCAGACGTTAACATTGTCTCAAATGCTAGCTGCACCACTAACTGCCTTGCTCCCCTAGCTAAGATCATTAATGACAACTTCGGTATTATTGAGG
GTTTGATGACCACTGTTCATGCCATCACTGCCACACAGAAGACCGTTGATGGTCCCTCGAGCAAGGACTGGAGAGGTGGCAGGGCCGCAAGCTTTAACAT
CATTCCCAGCAGCACTGGTGCTGCCAAGGCTGTTGGTAAGGTTCTTCCTGAGCTGAATGGCAAGCTTACGGGTATGTCTTTCCGGGTTCCCACTGTGGAT
GTGTCAGTTGTTGATCTCACTGTTAGAACCGAGAAGGCTGCATCATATGATGACATCAAGAAGGCTATCAAGGCTGCATCCGAGGGAAAACTCAAGGGGA
TCATGGGTTACGTCGAGGAGGATTTGGTCTCCACTGATTTTGTCGGTGACAGCAGGTCGAGCATCTTTGATGCCAAGGCTGGAATTGCTCTGAACGACCA
CTTCGTCAAGCTTGTCTCGTGGTATGACAACGAGTGGGGTTACAGCAACCGCGTTGTCGACCTGATCCGCCACATGGCCAAGACTCAGTAGAGCGTTCTG
CTTTCGTTTGTGGCGCCTGGTCAGAGGTGTCCCTGCTTTGTCTATGCGAAGAATAAATGTGGATGGTGTCGCCAGACGACGCCTGGTTCATGTTAGTTGG
ACATGAGTTACCTTCTGTTTTCCGCATCAACCTCTAGTATCTGTAATGGAGTTGCTAATCAAGTACTCTTTTTTGGTTGTGGTTTGTGAAGAATATA
page-top