Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2210
Contig Information
Length 981 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whhg11e08    whhg19h05    whhg13c19    whhg14j10    rwhhg11e08    rwhhg13c19    rwhhg14j10    rwhhg19h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 7.55413e-69
Total Hit Count 398
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2210
CCAGACGGCAGGTAAGGGAGGAGGAGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAGTGCGGCAAGGGCA
AGGTCTGGCTCGACCCCAATGAGGTCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTAAAGGATGGTTTCATCATCAGGAAGCC
TCAGAAGATCCACTCCAGGTCTCGTGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGGAGGCT
AGGCTCCCCACCAAGATCCTGTGGATGCGGAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACATGTACC
ATGACATGTACCTGAAGGTCAAGGGTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAGAAGAC
CCTCTCTGATCAGTTTGAGGCCAAGCGCGCCAAGAGCAAGGCAAGCAGGGAGAGGAAGCATGCCAGGAGGGAGGAGAGATTGGCTCAGGGCCCCAGAGAT
CATGCACCAGCACCAGCGGCTGCAGCTCCAGCTCCAGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGTCTGACATGAAGCTTTAGCTTT
CTGGTATCATGAAGGGTTAGCCTGATTTTGGAGCATCTGAAGTTCAGAACTGTTTTCTGTGCAATATCTGTGTGCCGCGTATGAGATACCTTAAATATCA
TATCGTGTTTGTTCTGTTGGATGTTGCTTATGCAGAGTTTCTTTAAACATTTCGGTTCACCGAACCTAGTTTTACATATTCTGTGCGTGCAAATTTATGT
ACCTACTGTGTTTGTGATGGTAATAGTGCCTGGGTGCCTTCAGTCATCAGAANCAGGTGATGGATCTTGGGCGCACAAAAG
page-top