Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2162
Contig Information
Length 814 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whhg5l13    rwhhg5l13    rwhhg6j01    rwhhg10d17    rwhhg12j11    rwhhg13o24    rwhhg8e16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase 2 [Triticum monococcum]
Score 737
Evalue 3.51904e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2162
TTTTTTTTTTGAATTACACATCGCTCTTTATTATCTTTCCAAGACTCAGGAAGAAAGAGCATTATGAGGGAACTACACAACAAAGAATATGATAAGTGAA
AGTGACAGAGCGACTAACAGAGCAAACTGCACATAGCTCAGCAGTTTCAGCGACTCAAAATGGAAAGGATAAATATATGAAATGACAATAAGAAACTTAG
CACTGACTACCATACAACAAGACCAGTGTAGAGCGTCGCTTCAATATCTAATGCTTCTTCTCACTTCCCAGGAGCAACATGATCCCGTCTTGACGAACTT
GAGAGGCGGCAGACCAAGAGAACGCCATGCTCTTAGGCAGATGCCTTGTCGAACTTGAGGGGCTTCACCACCTCCCAGGTGAAGTCGGCATCATCGCGGC
CAAAGTGACCGTAAGCAGCGGTCTTGATGAACCTGTTTCCACCTTTCTTCAAGTCCAGGTTGATGCTGATCATCCCGGGCCTGAAGTCAAAGTTCTCCTT
CACGAGCTTGAGGATCTCCCTGTCGGGGATCTTGCCGGTGCCGTAGGAGTCGACGAACACAGACAAAGGCTCAGGCACACCGATGGCGTATGAGATCTGC
ACAATGCAGCGGCGTGCGAGGCCGCTGGCGATGATGCTCTTGGCGGCCTGCCTGGCAATGTAGGCGCCACTGCGGTCGACCTTGGTTGGGTCCTTGCCAG
AGAAGGCACCGCCGCCGTGGGCTCCCCAGCCACCATAGGTGTCGATGATGATCTTGCGGCCGGTGAGACCGGCGTCACCGTGAGGGCCGCCGATGACNAA
NCGGCCAGACGGGT
page-top