Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1956
Contig Information
Length 768 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 18 Clones [Download: CSV  ,  FASTA ]
whfl29i12    whfl5h21    whfl35g16    whfl5k21    whfl10e02    whfl9i12    whfl33l17    whfl31h12    whfl7n22    whfl51d14    rwhfl7n22    rwhfl5k21    rwhfl29i12    rwhfl10e02    rwhfl9i12    rwhfl51d14    rwhfl35g16    rwhfl33l17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit riboflavin biosynthesis protein [Chlamydomonas reinhardtii] >gi|158273163|gb|EDO98955.1| riboflavin biosynthesis protein [Chlamydomonas reinhardtii]
Score 88
Evalue 0.5675
Total Hit Count 20
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1956
aatGCTGCTGTATCCTGTGCTacncgCTCTCCTCTATCTCTCTTCCATTATTGCCGTCGCCAGCTACCTCTCGTCTGCTCATGGCTCCGCCACACCCTAC
CTCAGCTCCAACGATGCGCGTGCGACGGAAGTGACGGCCGGAGCACTCGTCCTCTTCCACTCCGGCAGCCAAACCACCCGGATCTGGCGTCATCTTCCAC
TCCGGCGGCCAAATCACCTCGAGCCTACACAACGCCGGATCTACAGGAGGACGCGGTCCTCGTCCATGGATCTGGCCAAGGGAAATCATCTTCTTCATTG
TATCCGTCGGATCCGTGTTGGGATGGCAAAGCCGATTTCTGATGTCTTCCCCATGTAGTCGCGGGATTCCATCATCATTGCCGATTGCCAGTTGGG*CCG
CCGCGGTGAGAGCACACAGCTG*T*GCGGAGATGTCGG*CTTTGACGTTTGCTCAGAGGCCACCAGCGGTTGGACCATAAGGATTAGGATAAACCGCCTT
ACGAGCAACATTTGAAGAGGTCTGCTTTTGCAAGATTTGTGGAGTGCAAAAGCACAACATGTCTTGGTAGAAGAGATTTTTTGAAGGAGCCAAGGAAATT
GCCAAAATGTTTGAATGTGGTGTTCCGAAATGTGCGTTTGAAGCTAACTTTCTTTGGATGGTTGTTGTTGTTAGCCAAAGAGTTTCCAACTCAGGAAATC
CTTATTTATGTGCCGTTTCATGTAATCGCGAACTGTGTAATGTGACTTTACTattggacatggaccat
page-top