Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2117
Contig Information
Length 904 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whhg18i19    rwhhg13d02    rwhhg13f19    rwhhg14g21    rwhhg16a11    rwhhg18i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 1037
Evalue 6.97223e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2117
TTTTTTTTTTAAGACTAAAAGTAGCAGCCTAACATTCCAAAGCAGAGGATAAAAATGAGTAGTCTCAGAAGCTTCCATGTTTTGCCAAAAGCCAAAATTA
ACGACAGTACTCAAATGACACATCAACAGGGCGCATATCACACGGCGCTAACAGTAGCAAAACTTGCACTAAACTACTAGAGATCTCAAAAGCAGACATA
GATGGATTCAGGTAAACGCCTCATTTCTTCTTGATGGCAGCCTTGGTCACCTTGGCGCCGGTTGGGTCCTTCTTCTCCACACCCTTGATGACACCAACAG
CCACAGTTTGCCTCATGTCACGGACAGCAAAACGACCAAGAGGAGGGTAAGTGGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTAT
GCCAGCATCACCATTCTTGAGGAACTTGGGCGCGGCCTCTATCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCAGCAAACTTGACAGCAATG
TGCGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTGG
CAGGGTCATCCTTGGAGTTGGATGCAACAAAACCACGCTTCAGATCCTTCACGGCAACGTTCTTGACGTTGAAGCCGACGTTGTCACCAGGAAGCGCCTC
CAGGAGAGACTCGTGGTGCATCTCAACAGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTCA
ACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACGTCCTGGAGGGGAAGACGGAGGGGGCTTGTCTGANGGCCTCTTGGGCTCGTTGATC
TGGT
page-top