Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig2012
Contig Information
Length 1007 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whhg16c01    whhg17b16    whhg9j07    rwhhg9j07    rwhhg17b16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 4.54943e-117
Total Hit Count 494
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig2012
GCCCCGACGCTCAAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCCAAGGGGAGGAA
GGGAAGCAAGAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCGGCAAGACCCTC
GTGTCCAGGACGCAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGAGGACCAGGCCT
ACAGGAAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCAGGTCTCTTGT
GAGGAAGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCGCCATTGGCTTCACCAAGAGACGCCCA
AACCAGGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCAAGCTGTGACT
TGAAGGAGCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAGGCATCTTCCCCCTCCAGAACGTGTACGTCCGCAA
GGTGAAGATCCTGAAGGCCCCCAAGTTCGACCTGGGGAAGCTCATGGAGGTTCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGACAGGCCTGCT
GATGGAGATGAGGTGATTCCTGGAGCAGAGGAGGTTGCTGCTGCTGAGTAGAGGATAGAAGTTGCTATTTTGCTGCTTCATATCTAGAAGATGATATATG
TGCCACCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGTGTTCCGCTATCTTATTTTGT
TCGTGTT
page-top