Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1944
Contig Information
Length 656 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 18 Clones [Download: CSV  ,  FASTA ]
rwhfl45l03    rwhfl29j16    rwhfl10a17    rwhfl19i17    rwhfl12p13    whfl45l03    whfl10a17    rwhfl19i06    whfl19i06    whfl29j16    rwhfl17m21    whfl12p13    rwhfl30i03    rwhfl17m22    whfl17m21    whfl19i17    whfl30i03    whfl17m22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit acidic ribosomal protein P2 [Triticum aestivum] >gi|32400824|gb|AAP80644.1|AF475123_1 acidic ribosomal protein P2a-2 [Triticum aestivum]
Score 298
Evalue 1.82099e-25
Total Hit Count 330
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1944
ttgttaagcaccaaaatTGGATAGCAAAGGTATGGTTCACCAGTAAATCAACCAGCAACCAGGGGCTGAATTACATATCAAAACATTGTCTTGCCAGCGT
TTCACAACTCAGCTAAATAAAGGCTAAAACATCATTGACTCTAGTTTCCTGGCCAAGGATAGATACTGCAGACACAAGATGCCCCACGACTTAGTCGAAC
AGACTGAAGCCCATGTCATCATCACTCTCT*TCCTTCTCCACGACCTTCTCTTCTTTCTTCGACTCAGCTGCAGGGGGCAGCAGCACCACCAGCAGCAGG
AGCAGCGGCTGAAACAGCCACACC*ACCACCGCCAGATGGAACCGCAGCAAACTTCTCCCTACC*AGCAGCCAAGAGCTCAGTGATGTCCTTGCCCTTCA
CTTGGGACAGCATGAGTTCCATCTTCTCATTGTCGATTTCACAACCAACTGACTCAAGAATGGATGTCAGGTCCTCTGCAGAGGGGCTGGCGTTGCCAGA
GAGGTAAGCAAGCAGATAGGCAGCGATGAACTTCATCTTGAATCGGTGAAGGAAGGAGAGAGCTGAAGGCGCGGCGGCGGCGGAGGGCTCGAGCGATCTG
CTAGGGTTTCTGCGAGTAAGGGCTGTTCCAGACAGCGATGACTCGAGAACCGAAac
page-top