Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_HGCPCDAM_all.Contig1959
Contig Information
Length 1251 bp
Tissue Anther at meiosis of MT4B CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whhg20b21    whhg1o20    rwhhg1o20    rwhhg20b21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 3.96587e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_HGCPCDAM_all.Contig1959
CCTCCTCCTAAACCACTCTCCCTATCCCCGTGTCCAGAATCTACCCCCCGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGC
AGGACAAATCGGATATGCTCTTGTTCCCATGATTGCCAGGGGAGTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCT
GCTGAAGCTCTTAAAGGCGTCAAGATGGAGTTGATCGATGCCGCATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTTGAGGCTTGCACTG
GTGTGAATGTTGCGGTTATGGTTGGTGGATTCCCCAGGAAGGAAGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGC
ATCTGCTCTTGAAGCTCATGCAGCCCCCAATTGCAAGGTTTTGGTTGTTGCCAACCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCT
ATCCCTGAGAAGAACATCAGTTGTTTGACCCGCCTAGACCACAACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTTAAGA
ATGCTATTATCTGGGGTAATCACTCGTCCAGTCAGTATCCTGATGTTAACCATGCCACTGTGAAGACTCCCAGTGGAGAGAAGCCTGTTCGTGAACTTGT
TCAAGATGATGAATGGCTAAATGGGGAGTTCATTGCCACTGTCCAGCAGCGTGGTGCTGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCT
GCCAGCTCAGCTTGTGATCACATCCGTGACTGGGTTCTGGGAACCGCTGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGC
CTGCTGGTCTTATCTACTCCTTCCCAGTAACGTGCAGTGGTGGTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGA
TGCGACCGCCCAGGAGCTGTCAGAGGAGAAGGCGTTGGCCTACTCATGCCTGGCGTAAATCCACATTCGAAGGGCAGCTGCTCCTCTGGATGTTTTGAAT
AAATGAAACCTTCCGCTCTTTAGAAACTCTCGTCTCCACCCAGAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCAAGTGTGTATGAA
TGAGGCTTGTAGCTCCCCTTTTGCCTGATGATTTACAGGACAGTACATTGC
page-top