Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1936
Contig Information
Length 736 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 18 Clones [Download: CSV  ,  FASTA ]
rwhfl42n17    rwhfl31m13    rwhfl10a15    rwhfl11n21    rwhfl31j06    rwhfl27g03    rwhfl52g10    rwhfl32m13    rwhfl10a16    rwhfl36n22    whfl32m13    whfl52g10    whfl11n21    whfl31m13    whfl42n17    whfl31j06    whfl27g03    whfl10a16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0342200 [Oryza sativa (japonica cultivar-group)] >gi|31043871|emb|CAD91551.1| eukaryotic translation initiation factor 1A [Oryza sativa (japonica cultivar-group)] >gi|54290949|dbj|BAD61630.1| putative eukaryotic translation initiation factor 1A [Oryza sativa Japonica Group] >gi|113595611|dbj|BAF19485.1| Os06g0342200 [Oryza sativa (japonica cultivar-group)] >gi|125555219|gb|EAZ00825.1| hypothetical protein OsI_22855 [Oryza sativa Indica Group] >gi|125597122|gb|EAZ36902.1| hypothetical protein OsJ_020385 [Oryza sativa (japonica cultivar-group)] >gi|215708861|dbj|BAG94130.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767517|dbj|BAG99745.1| unnamed protein product [Oryza sativa Japonica Group]
Score 568
Evalue 1.14732e-56
Total Hit Count 322
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1936
atacGACGAACACTATAATCCGACAATTATTTAAGCACCTCAAATCACAACGATTTCTCGTTACCAAATCCATCAATCCACAACAGCCCACCGACCGACC
GACACAGACAGACACGGACGCTATTAGAACAGAATAGAACACAAAGTATATCGAGCGAGGGAGGAGGAGGGGAAAAAAGCTTAGATCTTGTCGATGTCCT
CGTCCTCGAACTGGATGTAGTCGCTGTCGCCCTCGCCCTCCTCGGGGCCGTCGACGTCGACGCCCTCGTTGAGGCGGAGCGTGTCGGGGAGCTCCCCGTA
GGCCTTGAGCAGGCGGGCCTCGTCGTTCATGTACTTGAGGATGACGTCGGCCTTGTCGTCCTGGTA*GTCGCGGAGGCCGACGAGGACGATGTCCCCGGC
GGCGATCCAGACCTTCTTGTGCATCTTGCCCCGGATGTGGCAGAGGCGCTTGGTGCCGTCGACGCA*GATGGCCTCGCAGCGCCCGTTGCCGAGCATCCG
CGTCACCTGCGCGTACTCCTGCCCGTCCTCCTTGAACACCAGCTCGCGCTTGTCGTCGTCGGCCTCGTTCTTGCCCC*TCTTGCGGTTCTTGCCTCCCTT
ACCCTTGTTCTTCGGCATGGCTGGCTGG*CTGGGG*TGGGG*CTGGCTCTGGCTTGGGTCGCGGCGACGGAGCTGGACGAAACCCTCGGCTTTAGATCGA
GATGGGGAGCGGTGG*TGGTGCGGTCTGCGGTTTct
page-top