Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig1925
Contig Information
Length 955 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 17 Clones [Download: CSV  ,  FASTA ]
rwhfl35k06    rwhfl1i05    rwhfl2j01    rwhfl46a23    rwhfl10a12    rwhfl48n07    rwhfl54f10    rwhfl54p15    rwhfl3k03    rwhfl37a10    rwhfl47e23    rwhfl48p07    whfl7c18    whfl4m22    whfl14o08    whfl10f09    whfl6l10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_27370 [Oryza sativa Indica Group]
Score 782
Evalue 2.78742e-81
Total Hit Count 74
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig1925
atcgcagaaaaacggAGACAATGCAGG*TCACAgcaGTAGCACAGTACAGGGCCCAGTACCAAGAAAACACA*G*ACG*AGTTACATCAAAGTTCAGACT
TCGG*AATCATGGTCCCTCTCCTCACTCTCTCCAACACTCTCTTCTTCCTCGCAGAAACGCCGGCTCAATCATTCAATCACAAGGCGACACACGCACACA
GACACCATTGCCACACATCGCACACGGTTTTATTTGGACACAGCAACATTATTCGCTACCAGCGGCAGAGGACTACGACGACGACGGACGGACGGACGGA
CGGACGGCGACTAGGACGACTTGGGGGGCTTGTCCCCGGACTAATCCATGGCGATGTGTCGATGGCAATGCGGCAGCTCATCTACCAGGGGAGGATCTTC
CAGCGCTGGTTGTCGCCCTCGCACCACTTCCAGAGCACGATCTCGGTGCCGTCGTGGACGCCGCCGTGGGCCTTGTCGCCGTGGAAGGCGTCGAAGTTGA
GGTAGATGTTGTTCACCATGCGCACGCAGCGGAAGCCCTTGCCcacgtcgtngcTCTCCGTCCACAGCACCGACTCGTCCTGGTACGCCGGGTTGAACGG
CACCAGCTTCACGGGGTGGGACTGGCCGATGGAGTGCTTGACGGCGAGGCCGGTGGCCTTGTTGACGAGCGCGAAGGCCGGCATGCCCTCCTCGTCCTTG
ACGGTGGTGCTGAAGCGCATGTCCTTGAGCCAGTGCTGGGTCTCGTCCTTGGGGTTGACGGGGGCGAGCACCACCTCGCCGTCGCGGACGGCGAGGCAGT
AGTCCTCCGAGGCCCGGCAGTAGATCTTGAAGATCTGGTTGGGGCCCGACGCCGCCGGCGCCTGGTCCTTGTGGTGGTGCCCGAACCCGAACATCTTGGC
GGCGAGGAGAGCGTGTGTGATCGACTAGAGAATGGTTGGAGCTGTGTGAGTGAgt
page-top